The Experts below are selected from a list of 13704 Experts worldwide ranked by ideXlab platform

Leroy Gardner - One of the best experts on this subject based on the ideXlab platform.

  • experimental and numerical studies of laser welded stainless steel channel sections under combined compression and major Axis Bending moment
    Thin-walled Structures, 2020
    Co-Authors: Yating Liang, Yueling Long, Ou Zhao, Leroy Gardner
    Abstract:

    Abstract This paper presents an in-depth experimental and numerical investigation into the behaviour of laser-welded stainless steel channel sections under combined compression and Bending moment about the major Axis. Two laser-welded austenitic stainless steel plain channel sections were considered in the experimental investigation, and for each channel section, four eccentrically loaded stub column tests were conducted under various initial loading eccentricities. The experimental results were then adopted in a numerical investigation for the validation of finite element models, by means of which parametric studies were conducted to generate further structural performance data over a wider range of cross-section sizes and initial loading eccentricities. Both the obtained experimental and numerical results were carefully analysed and then used to evaluate the accuracy of the current codified design rules for welded stainless steel channel sections under combined compression and major Axis Bending. The evaluation results generally revealed that the codified design rules yield excessively conservative and scattered resistance predictions, owing to the neglect of the favourable material strain hardening of stainless steel and the beneficial stress redistribution within channel sections under combined loading. An improved design approach has been proposed through extension of the deformation-based continuous strength method (CSM) to the case of laser-welded stainless steel channel sections under combined compression and major Axis Bending. Quantitative evaluation of the new design approach was made through comparing the predicted resistances against the experimental and numerical failure loads, with the results revealing that the new design approach yields a much higher level of design accuracy and consistency than the current codified design rules. Finally, statistical analyses have been conducted to confirm the reliability of the new design approach according to EN 1990.

  • stainless steel channel sections under combined compression and minor Axis Bending part 2 parametric studies and design
    Journal of Constructional Steel Research, 2019
    Co-Authors: Yating Liang, Yueling Long, Ou Zhao, Leroy Gardner
    Abstract:

    Abstract Following the experimental study and finite element (FE) model validation described in the companion paper, numerical parametric studies and the evaluation of design provisions for stainless steel channel sections under combined axial compressive load and minor Axis Bending moment are presented herein. The parametric studies were carried out to generate additional structural performance data over a wider range of cross-section aspect ratios and slendernesses, loading combinations and Bending orientations. The test data and numerical results have been carefully analysed to develop a comprehensive understanding of the structural performance of stainless steel channel sections under combined compression and minor Axis Bending moment, and to assess the accuracy of the existing design provisions in Europe and North America. Comparisons of ultimate loads from the tests and FE simulations with the codified resistance predictions revealed that the current design standards typically under-estimate the capacity of stainless steel channel sections under combined compression and minor Axis Bending moment; this is attributed primarily to the neglect of material strain hardening and the employment of conservative interaction formulae. Improved design rules featuring more efficient interaction curves, anchored to more precise end points (i.e. cross-section resistances under pure compression and Bending moment), are then proposed and presented. The new design proposals are shown to yield both more accurate and more consistent resistance predictions over the existing design provisions. Finally, statistical analyses are presented to confirm the reliability of the new design proposals according to EN 1990.

  • stainless steel channel sections under combined compression and minor Axis Bending part 1 experimental study and numerical modelling
    Journal of Constructional Steel Research, 2019
    Co-Authors: Yating Liang, Yueling Long, Ou Zhao, Leroy Gardner
    Abstract:

    Abstract The local cross-section behaviour of stainless steel channel sections under the combined actions of axial compression and minor Axis Bending moment is investigated in the present paper and its companion paper, based on a comprehensive experimental and numerical study. Two channel section sizes were considered in the experimental programme, with the test specimens laser-welded at the two flange-to-web junctions from hot-rolled EN 1.4307 and EN 1.4404 austenitic stainless steel plates. The experiments involved initial local geometric imperfection measurements and 15 eccentrically loaded stub column (combined loading) tests. The loading eccentricity was varied to achieve a range of ratios of axial compression to minor Axis Bending moment; both orientations of Bending (web in compression and web in tension) were considered. The test setup and procedures, together with the key experimental observations, including the load-carrying and deformation capacities, load-end rotation histories and failure modes, are fully reported. A finite element simulation study is then presented, in which the models were first validated against the obtained test results and then employed, in the companion paper, for parametric investigations and the assessment of design provisions.

  • Member stability of stainless steel welded I-section beam-columns
    Journal of Constructional Steel Research, 2019
    Co-Authors: Lu Yang, Leroy Gardner, Menghan Zhao, Keyang Ning, Jie Wang
    Abstract:

    Abstract A comprehensive experimental and numerical study is presented into the behaviour of stainless steel welded I-section beams-columns. Twenty test specimens were fabricated from grade 304 (EN 1.4301) austenitic and grade 2205 (EN 1.4406) duplex stainless steel plates – ten were tested under major Axis Bending plus compression and ten under minor Axis Bending plus compression. Material tensile coupon tests and geometric imperfection measurements were also conducted. Numerical models were developed, calibrated against the test results and subsequently employed in parametric studies considering a wider range of specimen geometries. Based on the obtained test and numerical results, the accuracy and reliability of existing design rules given in EN 1993-1-4 and AISC DG 27, as well as recent proposals, were assessed.

Ben Young - One of the best experts on this subject based on the ideXlab platform.

  • design of cold formed lean duplex stainless steel members in combined compression and Bending
    Journal of Structural Engineering-asce, 2015
    Co-Authors: Yuner Huang, Ben Young
    Abstract:

    AbstractThe structural performance and design of cold-formed lean duplex stainless steel members in combined compression and Bending are investigated. A wide range of square and rectangular hollow sections has been performed by finite-element analysis. A finite-element model has been developed and verified against the available test data for lean duplex stainless steel members subjected to axial compression and minor Axis Bending. An extensive parametric study was conducted using the verified finite-element model, and 150 finite-element analysis results were obtained. A total of 233 data, including the numerical results obtained in this study as well as the experimental and numerical data from the literature, are compared with design predictions from the current American, Australian/New Zealand, and European specifications for stainless steel structures. Reliability analysis was carried out to assess the reliability of these design rules for the lean duplex stainless steel beam-column members. It is shown...

  • Strength and Behavior of Cold-Formed Steel Z-Sections Subjected to Major Axis Bending
    Journal of Structural Engineering, 2006
    Co-Authors: Ngoc T. B. Nguyen, Tat Ching Fung, Ben Young
    Abstract:

    This paper presents a study on the strength and behavior of cold-formed steel Z -sections with simple and complex stiffeners subjected to major Axis Bending. The study involved both experimental and numerical investigations, in which a series of specimens were examined. All specimens were failed by the combined mode of shear and moment. The results from the investigations were analyzed and compared with the combined moment and shear strengths predicted by international design rules. The suitability of the design rules in predicting the combined capacity of Z -section with complex stiffeners was assessed through a reliability analysis.

  • Measurement techniques in the testing of thin-walled structural members
    Experimental Mechanics, 2003
    Co-Authors: Ben Young, Kim J.r. Rasmussen
    Abstract:

    The paper describes methods for measuring displacements and end moments in the testing of thin-walled columns. The complete spatial deformation of a column can be captured by using local and overall deformation measurement frames. The local frame involves spring-loaded levers and roller bearings to mount the frame on to the specimen. The overall frame slides along high-precision shafts using linear ball bearings. Fixed-ended bearings are used to measure minor and major Axis Bending moments as well as the applied load. The bearings allow the line of action of the applied force to be determined.

Yating Liang - One of the best experts on this subject based on the ideXlab platform.

  • experimental and numerical studies of laser welded stainless steel channel sections under combined compression and major Axis Bending moment
    Thin-walled Structures, 2020
    Co-Authors: Yating Liang, Yueling Long, Ou Zhao, Leroy Gardner
    Abstract:

    Abstract This paper presents an in-depth experimental and numerical investigation into the behaviour of laser-welded stainless steel channel sections under combined compression and Bending moment about the major Axis. Two laser-welded austenitic stainless steel plain channel sections were considered in the experimental investigation, and for each channel section, four eccentrically loaded stub column tests were conducted under various initial loading eccentricities. The experimental results were then adopted in a numerical investigation for the validation of finite element models, by means of which parametric studies were conducted to generate further structural performance data over a wider range of cross-section sizes and initial loading eccentricities. Both the obtained experimental and numerical results were carefully analysed and then used to evaluate the accuracy of the current codified design rules for welded stainless steel channel sections under combined compression and major Axis Bending. The evaluation results generally revealed that the codified design rules yield excessively conservative and scattered resistance predictions, owing to the neglect of the favourable material strain hardening of stainless steel and the beneficial stress redistribution within channel sections under combined loading. An improved design approach has been proposed through extension of the deformation-based continuous strength method (CSM) to the case of laser-welded stainless steel channel sections under combined compression and major Axis Bending. Quantitative evaluation of the new design approach was made through comparing the predicted resistances against the experimental and numerical failure loads, with the results revealing that the new design approach yields a much higher level of design accuracy and consistency than the current codified design rules. Finally, statistical analyses have been conducted to confirm the reliability of the new design approach according to EN 1990.

  • stainless steel channel sections under combined compression and minor Axis Bending part 2 parametric studies and design
    Journal of Constructional Steel Research, 2019
    Co-Authors: Yating Liang, Yueling Long, Ou Zhao, Leroy Gardner
    Abstract:

    Abstract Following the experimental study and finite element (FE) model validation described in the companion paper, numerical parametric studies and the evaluation of design provisions for stainless steel channel sections under combined axial compressive load and minor Axis Bending moment are presented herein. The parametric studies were carried out to generate additional structural performance data over a wider range of cross-section aspect ratios and slendernesses, loading combinations and Bending orientations. The test data and numerical results have been carefully analysed to develop a comprehensive understanding of the structural performance of stainless steel channel sections under combined compression and minor Axis Bending moment, and to assess the accuracy of the existing design provisions in Europe and North America. Comparisons of ultimate loads from the tests and FE simulations with the codified resistance predictions revealed that the current design standards typically under-estimate the capacity of stainless steel channel sections under combined compression and minor Axis Bending moment; this is attributed primarily to the neglect of material strain hardening and the employment of conservative interaction formulae. Improved design rules featuring more efficient interaction curves, anchored to more precise end points (i.e. cross-section resistances under pure compression and Bending moment), are then proposed and presented. The new design proposals are shown to yield both more accurate and more consistent resistance predictions over the existing design provisions. Finally, statistical analyses are presented to confirm the reliability of the new design proposals according to EN 1990.

  • stainless steel channel sections under combined compression and minor Axis Bending part 1 experimental study and numerical modelling
    Journal of Constructional Steel Research, 2019
    Co-Authors: Yating Liang, Yueling Long, Ou Zhao, Leroy Gardner
    Abstract:

    Abstract The local cross-section behaviour of stainless steel channel sections under the combined actions of axial compression and minor Axis Bending moment is investigated in the present paper and its companion paper, based on a comprehensive experimental and numerical study. Two channel section sizes were considered in the experimental programme, with the test specimens laser-welded at the two flange-to-web junctions from hot-rolled EN 1.4307 and EN 1.4404 austenitic stainless steel plates. The experiments involved initial local geometric imperfection measurements and 15 eccentrically loaded stub column (combined loading) tests. The loading eccentricity was varied to achieve a range of ratios of axial compression to minor Axis Bending moment; both orientations of Bending (web in compression and web in tension) were considered. The test setup and procedures, together with the key experimental observations, including the load-carrying and deformation capacities, load-end rotation histories and failure modes, are fully reported. A finite element simulation study is then presented, in which the models were first validated against the obtained test results and then employed, in the companion paper, for parametric investigations and the assessment of design provisions.

  • In-plane Bending behaviour and capacities of S690 high strength steel welded I-section beams
    Journal of Constructional Steel Research, 2019
    Co-Authors: Yao Sun, Yating Liang, Ou Zhao
    Abstract:

    Abstract The present paper describes an in-depth experimental and numerical investigation into the in-plane flexural behaviour and Bending moment capacities of S690 high strength steel welded I-section beams. The experimental investigation was conducted on six different welded I-sections fabricated from the same batch of 5 mm thick S700MC high strength steel hot-rolled plates by means of gas metal arc welding, and involved initial local geometric imperfection measurements and twelve in-plane four-point Bending tests, with six performed about the cross-section major principal axes and another six conducted about the cross-section minor principal axes. Following the experimental study, a numerical investigation was performed, where the developed finite element models were firstly validated against the test results and then used to perform parametric studies to generate further structural performance data over a broader range of cross-section sizes. The obtained experimental and numerical results were carefully analysed and then adopted to evaluate the accuracy of the existing slenderness limits (for classifications of plate elements and cross-sections) and local buckling design rules for S690 high strength steel welded I-sections in Bending, as set out in the European, Australian and American standards. The results of the evaluation revealed that the codified slenderness limits are generally safe when used for the classification of the constituent plate elements of the examined S690 high strength steel welded I-section beams, except for that given in the American specification for slender/non-slender outstand elements in compression. All of the three considered design standards were shown to yield accurate cross-section Bending moment capacity predictions for compact (Class 1 and 2) S690 high strength steel welded I-section beams bent about both the principal axes and non-compact (Class 3) S690 high strength steel welded I-section beams bent about the major principal axes, but resulted in a rather high level of conservatism in predicting the cross-section Bending moment capacities for non-compact (Class 3) S690 high strength steel welded I-sections in Bending about the minor principal axes and slender (Class 4) S690 high strength steel welded I-sections subjected to both major-Axis Bending and minor-Axis Bending.

Dinar Camotim - One of the best experts on this subject based on the ideXlab platform.

  • On the plastic moment of I-sections subjected to moderate shear forces
    Thin-Walled Structures, 2014
    Co-Authors: Rodrigo Gonçalves, Tiago Coelho, Dinar Camotim
    Abstract:

    Abstract This paper presents an investigation concerning the plastic moment–shear ( M – V ) interaction of elastic–perfectly plastic compact I-section cantilever beams, focusing specifically on the effect of small-to-moderate shear forces. First, rectangular beams are analysed and the accuracy of the classic solutions for the M – V interaction is assessed through comparisons with numerical results, obtained with 2D solid finite element models. Then, I-section beams under major Axis Bending are examined, using shell finite element models and also available analytical solutions. Finally, the biaxial Bending interaction for I-sections, together with uniaxial/biaxial shear, is investigated using 3D solid finite element models. A simple but accurate model for the biaxial Bending interaction is proposed, which is based on the behaviour of rectangular cross-sections.

  • GBT FORMULATION TO ANALYZE THE BUCKLING BEHAVIOR OF THIN-WALLED MEMBERS SUBJECTED TO NON-UNIFORM Bending
    International Journal of Structural Stability and Dynamics, 2007
    Co-Authors: Rui Bebiano, Nuno Silvestre, Dinar Camotim
    Abstract:

    In this paper, one investigates the local-plate, distortional and global buckling behavior of thin-walled steel beams subjected to non-uniform Bending moment diagrams, i.e. under the presence of longitudinal stress gradients. One begins by deriving a novel formulation based on Generalized Beam Theory (GBT), which (i) can handle beams with arbitrary open cross-sections and (ii) incorporates all the effects stemming from the presence of longitudinally varying stress distributions. This formulation is numerically implemented by means of the finite element method: one (i) develops a GBT-based beam finite element, which accounts for the stiffness reduction associated to applied longitudinal stresses with linear, quadratic and cubic variation, as well as to the ensuing shear stresses, and (ii) addresses the derivation of the equilibrium equation system that needs to be solved in the context of a GBT buckling analysis. Then, in order to illustrate the application and capabilities of the proposed GBT-based formulation and finite element implementation, one presents and discusses numerical results concerning (i) rectangular plates under longitudinally varying stresses and pure shear, (ii) I-section cantilevers subjected to uniform major Axis Bending, tip point loads and uniformly distributed loads, and (iii) simply supported lipped channel beams subjected to uniform major Axis Bending, mid-span point loads and uniformly distributed loads — by taking full advantage of the GBT modal nature, one is able to acquire an in-depth understanding on the influence of the longitudinal stress gradients and shear stresses on the beam local and global buckling behavior. For validation purposes, the GBT results are compared with values either (i) yielded by shell finite element analyses, performed in the code ANSYS, or (ii) reported in the literature. Finally, the computational efficiency of the proposed GBT-based beam finite element is briefly assessed.

  • GBT-Based Finite Element Formulation to Analyse the Buckling Behaviour of Thin-Walled Members Subjected to Non-Uniform Bending
    III European Conference on Computational Mechanics, 1
    Co-Authors: Rui Bebiano, Nuno Silvestre, Dinar Camotim
    Abstract:

    In this paper, one investigates the local-plate, distortional and global buckling behaviour (critical bifurcation loads and buckling mode shapes) of thin-walled steel beams subjected to non-uniform Bending moment diagrams, i.e., under the presence of longitudinal stress gradients. In order to achieve this goal, one begins by developing and numerically implementing a beam finite element formulation based on Generalised Beam Theory (GBT), which (i) can handle beams with arbitrary open cross-sections and (ii) incorporates all the effects stemming from the presence of longitudinally varying stress distributions. After presenting the main concepts, procedures and assumptions involved in the above formulation, one addresses the derivation of the equilibrium equation system that needs to be solved in the context of a GBT buckling analysis. Particular attention is devoted to the main steps involved in the determination of the elementary linear and geometric stiffness matrices, as they must incorporate the stiffness reduction stemming from the presence of the non-uniform Bending moments (longitudinal stress gradients) and also of the pre-buckling shear stresses caused by them - the inclusion of this last effect constitutes an original contribution within the context of GBT buckling analyses. Then, in order to illustrate the application and capabilities of the proposed GBT-based finite element formulation, one presents and discusses numerical results concerning thin-walled steel Ibeams acted by various (uniform and non-uniform) Bending moment diagrams. In particular, one analyses (i) cantilevers subjected to uniform major Axis Bending (Fig. 1(a)), tip point loads (Fig. 1(b)) and uniformly distributed loads (Fig. 1(c)), as well as (ii) simply supported lipped beams subjected to uniform major Axis Bending, mid-span point loads and uniformly distributed loads by taking full advantage of the GBT modal features, one is able to acquire a much deeper understanding about the influence of the longitudinal stress gradients and shear stresses on the beam local and global buckling mode shapes. For validation purposes, some GBT-based critical loads/moments and buckling mode shapes are compared with values either (i) yielded by shell finite element analyses, performed in the code ANSYS, or (ii) reported in the literature. Finally, one assesses the computational efficiency of the buckling analyses carried out using the proposed GBT-based beam finite element, by comparing the number of degrees of freedom involved with those required to obtain equally accurate results with discretisations in shell finite elements (note that “uniform stress” GBT-based beam finite elements are no longer applicable). Open image in new window Figure 1 Local-plate buckling mode shapes of I-section cantilevers subjected to (a) uniform major Axis Bending, (b) a tip point load and (c) a uniformly distributed load.

David L. Beveridge - One of the best experts on this subject based on the ideXlab platform.

  • Structure and Axis curvature in two dA6·dT6 DNA oligonucleotides: Comparison of molecular dynamics simulations with results from crystallography and NMR spectroscopy
    Biopolymers, 2004
    Co-Authors: Surjit B. Dixit, Felicia Pitici, David L. Beveridge
    Abstract:

    Molecular dynamics (MD) simulations have been performed on the A6 containing DNA dodecamers d(GGCAAAAAACGG) solved by NMR and d(CGCAAAAAAGCG) solved by crystallography. The experimental structures differ in the direction of Axis Bending and in other small but important aspects relevant to the DNA curvature problem. Five nanosecond MD simulations of each sequence have been performed, beginning with both the NMR and crystal forms as well as canonical B-form DNA. The results show that all simulations converge to a common form in close proximity to the observed NMR structure, indicating that the structure obtained in the crystal is likely a strained form due to packing effects. A-tracts in the MD model are essentially straight. The origin of Axis curvature is found at pyrimidine-purine steps in the flanking sequences.

  • Molecular dynamics simulations of B '-DNA: sequence effects on A-tract-induced Bending and flexibility.
    Journal of molecular biology, 2001
    Co-Authors: Kevin J. Mcconnell, David L. Beveridge
    Abstract:

    Molecular dynamics (MD) simulations including water and counterions are reported on five examples of A-tract DNA oligonucleotide dodecamer duplexes for which crystal structures are available, the homopolymeric duplex sequences poly(dA) and poly(dG), and two related sequences that serve as controls. MD was performed using the AMBER suite of programs for 3 ns on each sequence. These results, combined with previously reported MDs on 25-mer and 30-mer oligonucleotides on sequences with phased A-tracts carried out under a similar simulation protocol, are used to examine salient issues in the structural chemistry of ApA steps and A-tract induced Axis Bending. MD modeling successfully describes the distinctive B' structure of A-tracts in solution as essentially straight (wedge angles of

  • Nucleic acids: theory and computer simulation, Y2K.
    Current opinion in structural biology, 2000
    Co-Authors: David L. Beveridge, Kevin J. Mcconnell
    Abstract:

    Molecular dynamics simulations on DNA and RNA that include solvent are now being performed under realistic environmental conditions of water activity and salt. Improvements to force-fields and treatments of long-range interactions have significantly increased the reliability of simulations. New studies of sequence effects, Axis Bending, solvation and conformational transitions have appeared.

  • Molecular dynamics simulations of an oligonucleotide duplex with adenine tracts phased by a full helix turn.
    Journal of molecular biology, 1998
    Co-Authors: Matthew A. Young, David L. Beveridge
    Abstract:

    A theoretical model of a DNA oligonucleotide duplex featuring A-tracts phased by a full helix turn is developed based on molecular dynamics computer simulation. The extent to which this model agrees with relevant experimental data on Axis Bending and the relationship of A-tracts to Bending and other aspects of helix morphology is investigated. Specifically, a series of nanosecond-level molecular dynamics (MD) simulations have been carried out for the 25 bp duplex d(ATAGGCAAAAAATAGGCAAAAATGG) at various concentrations of saline solution. A 30 base-pair sequence composed of three 10 bp repeats of the BamHI recognition sequence ligated together, d(CGGGATCCCG. CGGGATCCCG.CGGGATCCCG), was simulated as a control. The MD was carried out using the AMBER 4.1 suite of programs, and utilized the Cornell et al. force-field with the electrostatic boundary conditions treated by the particle-mesh Ewald summation protocol. The MD results show that at a concentration of 60 mM KCl, 10 mM MgCl2 added salt plus minimal neutralizing cations, the MD model exhibits concerted Axis Bending to the extent of 15.5 degrees per A-tract. This compares favorably with the Bending per turn of 17 to 21 degrees inferred from cyclization experiments. The MD model also exhibits a progressive 5' to 3' narrowing of the minor-groove region of A-tracts, a feature inferred from DNA footprinting experiments. Analysis of the dynamic structure of the MD models shows that the origin of the Bending follows a junction-type Bending model with an admixture of mixed sequence effects, with A-tracts relatively straight, as in oligonucleotide crystal structures of sequences containing A-tracts. The results are shown to be sensitive to environmental conditions: MD on d(ATAGGCAAAAAATAGGCAAAAATGG) in neutralizing Na+ buffer results in markedly reduced curvature, and the removal of Mg2+ measurably affects Bending. Carrying out the simulations at experimental salt conditions appears to be essential to obtain an accurate account of the experimentally observed Bending.

  • Molecular Dynamics Simulations of DNA and a Protein-DNA Complex Including Solvent
    Molecular Engineering, 1995
    Co-Authors: David L. Beveridge, Kevin J. Mcconnell, Matthew A. Young, S. Vijayakumar, G. Ravishanker
    Abstract:

    The results of a recent nanosecond (ns) Molecules dynamics (MD) simulation of the d(CGCGAATTCGCG) double helix in water and a 100 ps MD study of the λ repressor-operator complex are described. The DNA simulations are analyzed in terms of the structural dynamics, fluctuations in the groove width and Bending of the helical Axis. The results indicate that the ns dynamical trajectory progresses through a series of three substates of B form DNA, with lifetimes of the order of hundreds of picoseconds (ps). An incipient dynamical equilibrium is evident. A comparison of the calculated Axis Bending with that observed in corresponding crystal structure data is presented. Simulation of the DNA in complex with the protein and that of the free DNA in solution, starting from the crystal conformation, reveal the dynamical changes that occur on complex formation.