The Experts below are selected from a list of 300 Experts worldwide ranked by ideXlab platform
Charles F. Rosenkrans - One of the best experts on this subject based on the ideXlab platform.
-
Tall Fescue Toxicosis Mitigation StRategies: Comparisons of Cow-calf Returns
Journal of Agricultural and Applied Economics, 2012Co-Authors: Stephen A. Smith, J. D. Caldwell, Michael P. Popp, Kenneth P. Coffey, John A. Jennings, Mary C. Savin, Charles F. RosenkransAbstract:Tall fescue toxicosis adversely affects Calving Rate and weight gains reducing returns to cow-calf producers in the south–central United States. This grazing study estimated animal and economic performance implications of endophyte-infected fescue and Calving season. Establishing novel endophyte-infected tall fescue on 25% of pasture acres resulted in improved Calving Rates (87% vs. 70%), weaning weights (532 lbs vs. 513 lbs), and partial returns per acre ($257 vs. $217). Additionally, fall-Calving cows had higher Calving Rates (91% vs. 67%), weaning weights (550 lbs vs. 496 lbs), and partial returns per acre ($269 vs. $199) than spring Calving cows.
-
Tall Fescue Toxicosis Mitigation StRategies: Comparisons of Cow-Calf Returns in Spring- and Fall-Calving Herds
Journal of Agricultural and Applied Economics, 2012Co-Authors: Stephen A. Smith, J. D. Caldwell, Michael P. Popp, Kenneth P. Coffey, John A. Jennings, Mary C. Savin, Charles F. RosenkransAbstract:Tall fescue toxicosis adversely affects Calving Rate and weight gains reducing returns to cow-calf producers in the south–central United States. This grazing study estimated animal and economic performance implications of endophyte-infected fescue and Calving season. Establishing novel endophyte-infected tall fescue on 25% of pasture acres resulted in improved Calving Rates (87% vs. 70%), weaning weights (532 lbs vs. 513 lbs), and partial returns per acre ($257 vs. $217). Additionally, fall-Calving cows had higher Calving Rates (91% vs. 67%), weaning weights (550 lbs vs. 496 lbs), and partial returns per acre ($269 vs. $199) than spring Calving cows.
-
Effects of body condition on measures of intramuscular and rump fat, endocrine factors, and Calving Rate of beef cows grazing common bermudagrass or endophyte-infected tall fescue.
Journal of animal science, 2010Co-Authors: Michael Looper, S. T. Reiter, B. C. Williamson, M. A. Sales, Dennis M. Hallford, Charles F. RosenkransAbstract:Multiparous beef cows were managed to achieve marginal (BCS = 4.7 ± 0.07; n = 106) or good (BCS = 6.6 ± 0.06; n = 121) body condition (BC) to determine the influence of forage environment on BW and BC changes, intramuscular fat percentage (IMF), rump fat (RF), and serum hormones during 2 yr. Cows within each BC were randomly assigned to graze either common bermudagrass (CB; n = 3 pastures/yr) or tox- ic endophyte-infected tall fescue (EI; n = 3 pastures/ yr) during a 60-d breeding season. Blood samples were collected at d 0, 30, and 60 of the breeding season, and serum concentrations of prolactin (PRL), IGF-I, and cortisol (CORT) were quantified; PRL and progester- one (P4) also were quantified 10 d before the breeding season (d −10). Body weight and BCS were recorded during the breeding season (d 0, 30, and 60). Cow IMF and RF were measured via ultrasonography at the start and end of the breeding season. Cows with increased (>1 ng/mL) P4 at the beginning of the breeding season (cyclic) had greater (P 0.10) among good- and marginal-BC cows grazing CB, as well as good-BC cows grazing EI; however, marginal-BC cows grazing EI had reduced (P 0.10) among good- (82%) and mar- ginal- (84%) BC cows grazing CB, and good-BC cows grazing EI (79%); however, marginal-BC cows grazing EI had a reduced (P = 0.04) Calving Rate (61%). Cattle grazing EI during the breeding season lost BC. That reduction in BC may be communicated to the pituitary via hormones that include IGF-I or PRL or both, re- sulting in decreased Calving Rates.
-
246 ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS WITHIN THE BOVINE HEAT SHOCK PROTEIN 70 GENE AND Calving RateS
Reproduction Fertility and Development, 2010Co-Authors: Charles F. Rosenkrans, M. Roe, M.a. Brown, Zelpha B. Johnson, H. Brown, Michael LooperAbstract:Heat shock proteins (Hsp) are induced by various stressors such as heat, cold, toxins, and oxygen deprivation. Our objective was to determine the relationship among polymorphisms in the Hsp70 gene, forage system, and Calving Rates. Genomic DNA for 77 cows was purified from the buffy coats of EDTA-treated whole blood. The cows were Angus (n = 20), Brahman (n = 26), and reciprocal crosses (n = 31). Cows were assigned to and remained on their respective forage system for the duration of the experiment (8 years). Forage systems were endophyte-infected toxic tall fescue (E+) or common bermudagrass (CB). Specific primers for bovine Hsp70 (HSP1778F: CGCTGGAGTCGTACGCCTTC; HSP2326R: CTTGGAAGTAAACAGAAACGGG) were used for PCR amplification of a 523-base segment (based on GenBank accession number U09861). The PCR product was sequenced in both directions. Seven single nucleotide polymorphisms (SNP) were identified, and they were located at base positions 1851 (n = 6), 1902 (n = 4), 1917 (n = 4), 1926 (n =4), 2033 (n = 20), 2087 (n = 6), and 2098 (n =4). Concentrations of Hsp70, Julian date, and lifetime Calving Rate were analyzed by ANOVA, with each SNP represented as the main effect in the model. Two SNP resulted in altered peptide sequences, also known as mis-sense mutations (1926, aspartic acid to glutamic acid, and 2033, glycine to alanine). Five unique haplotypes were deduced based on the SNP profile (GCGCGCT, GCGCCCT, ACGCGCT, GCGCGGT, GTTGGCA, respectively, for haplotype 1, 2, 3, 4, and 5). Plasma concentrations of Hsp70 were affected by an interaction (P < 0.05) between Hsp70 haplotype and forage system. Cows with haplotypes 4 and 5 consuming fescue had higher plasma Hsp70 concentrations than other cows (5.4, 5.1, 3.8, 5.1, 5.2, 5.1, 5.7, 4.2, 22.4, and 9 MSE 1.5 ng mL-1, respectively, for 1-5 CB and 1-5 E+). That same interaction tended (P < 0.09) to be associated with lifetime Calving percentage. Cows with haplotype 4 consuming bermudagrass had the lowest Calving Rate (58%). These results suggest that the Hsp70 gene in cattle is polymorphic, and those polymorphisms are related to cattle fertility.
Charles R. Warren - One of the best experts on this subject based on the ideXlab platform.
-
Relationship between tidewater glacier Calving velocity and water depth at the Calving front
Annals of Glaciology, 1991Co-Authors: Mauri S. Pelto, Charles R. WarrenAbstract:An analysis of the relationship between iceberg Calving Rates and water depth has been completed for 22 tidewater glaciers. A linear relationship provides reasonable accuracy, with a correlation coefficient of 0.85, for all tidewater glaciers examined, whether they be polar or tempeRate. The polar glaciers have a slightly lower Calving Rate for a given water depth. This relationship indicates a lower Calving Rate for water depths over 50 m than determined by Brown and others (1982). It is based only on glaciers or ice streams and cannot be applied to ice shelves.
С.j. Van Der Veen - One of the best experts on this subject based on the ideXlab platform.
-
Tidewater Calving
Journal of Glaciology, 1996Co-Authors: С.j. Van Der VeenAbstract:AbstractData from Columbia Glacier are used to identify processes that control Calving from a tempeRate tidewater glacier and to re-evaluate models that have been proposed to describe iceberg Calving. Since 1981, Columbia Glacier has been retreating rapidly, with an almost seven-fold increase in Calving Rate from the mid-1970s to 1993. At the same time, the speed of the glacier increased almost as much, so that the actual Rate of retreat increased more slowly. According to the commonly accepted model, the Calving Rate is linearly related to the water depth at the terminus, with retreat of the glacier snout into deeper water, leading to larger Calving Rates and acceleRated retreat. The Columbia Glacier data show that the Calving Rate is not simply linked to observed quantities such as water depth or stretching Rate near the terminus. During the retreat, the thickness at the terminus appears to be linearly correlated with the water depth; at the terminus, the thickness in excess of flotation remained at about 50 m. This suggests that retreat may be initiated when the terminal thickness becomes too small, with the Rate of retreat controlled by the Rate at which the snout is thinning and by the basal slope. The implication is that the rapid retreat of Columbia Glacier (and other comparable tidewater glaciers) is not the result of an increase in Calving as the glacier retreated into deeper water. Instead, the retreat was initiated and maintained by thinning of the glacier. For Columbia Glacier, the continued thinning is probably associated with the increase in glacier speed and retreat may be expected to continue as long as these large speeds are maintained. It is not clear what mechanism may be responsible for the speed-up but the most likely candidate is a change in basal conditions or subglacial drainage. Consequently, the behavior of tidewater glaciers may be controlled by processes acting at the glacier bed rather than by what happens at the glacier terminus.
R. Norland - One of the best experts on this subject based on the ideXlab platform.
-
Ground-based interferometric radar for velocity and Calving-Rate measurements of the tidewater glacier at Kronebreen, Svalbard
Annals of Glaciology, 2009Co-Authors: Cecilie Rolstad, R. NorlandAbstract:This paper presents the first attempt to measure the Calving Rate and flow velocity of the front of a glacier using ground-based high-range resolution interferometric radar at a high temporal Rate (2 Hz). The radar, operating at 5.75 GHz, is located � 4 km from the Calving front of Kronebreen, Svalbard. The radar measures a horizontal width of � 700 m of the front, and a range of 300 m. The latter includes the Calving front and 250 m up-glacier. We find that the glacier surface provides permanent scatterers, so spatially continuous movements at the front and at locations further up-glacier can be tracked. For � 8 hours we measured a large increase in velocity at the Calving front, which extended 30 m up-glacier, while further up-glacier the velocity was stable (� 2.5 m d -1 ) during the entire period. Two large Calving events were identified during this survey, removing 25 m of ice in the radar range direction normal to the ice front. The velocity of the front slowed to a stable 2.5 m d -1 after the events. During another data series the velocities were stable (� 2.5 m d -1 ) and no Calving events were identified. The method is promising for carrying out studies of processes at a Calving front, as it provides spatially continuous, high-frequency accuRate velocities from a safe distance to the glacier.
Mauri S. Pelto - One of the best experts on this subject based on the ideXlab platform.
-
Relationship between tidewater glacier Calving velocity and water depth at the Calving front
Annals of Glaciology, 1991Co-Authors: Mauri S. Pelto, Charles R. WarrenAbstract:An analysis of the relationship between iceberg Calving Rates and water depth has been completed for 22 tidewater glaciers. A linear relationship provides reasonable accuracy, with a correlation coefficient of 0.85, for all tidewater glaciers examined, whether they be polar or tempeRate. The polar glaciers have a slightly lower Calving Rate for a given water depth. This relationship indicates a lower Calving Rate for water depths over 50 m than determined by Brown and others (1982). It is based only on glaciers or ice streams and cannot be applied to ice shelves.
