The Experts below are selected from a list of 7095 Experts worldwide ranked by ideXlab platform

Tomasto Bautista, Alejandro Daniel - One of the best experts on this subject based on the ideXlab platform.

  • Efecto cicatrizante de la crema a base del extracto lipídico de Chenopodium Quinoa willd (quinua roja pasankalla) en ratones albinos con lesiones por heridas punzocortantes
    'Universidad Inca Garcilaso de la Vega', 2019
    Co-Authors: Montalvo Correa, Josselyn Naydu, Tomasto Bautista, Alejandro Daniel
    Abstract:

    The objective of the study was to determine the healing effect of the cream based on the lipid extract of Chenopodium Quinoa Willd (Red Quinua Pasankalla) in albino mice with puncture wound injuries. The research is of applied type and experimental design. The Chenopodium Quinoa Willd grains are from the Puno region and purchased from the National Institute of Agrarian Innovation (INIA). The secondary metabolites were determined by the phytochemical march using the extract with petroleum ether of Chenopodium Quinoa Willd. To obtain the lipid extract, the Soxhlet method was used, determining the natural oil content; the extraction was carried out with the petroleum ether solvent at a temperature between 30 ° - 40 ° C. For topical pharmacological research, a base cream was prepared, to which concentrations of extract at 10, 20 and 30 percent were added. and 1 percent silver sulfadiazine (cream) was used as a reference. It took 30 male albino mice of Mus Muculus strain, with 30 g +/- 5 g of weight divided into 5 groups, where the technique of induced injury was used, which consists of making a cut with a scalpel blade in the dorsal part of the mouse previously depilated and the cream was applied in the different concentrations. On the eighth day of the procedure, the mice were sacrificed with intraperitoneal sodium pentobarbital, the equipment was used (tension equipment with sand) to measure wound closure, obtaining favorable results, which were analyzed by statistical tests: ANOVA and test of Tukey. The results of the study showed that the petroleum ether extract of Chenopodium Quinoa Willd contains phenolic compounds, flavonoids, free amino acids, oils and fats. It was demonstrated that the cream based on the lipid extract of Chenopodium Quinoa Willd at 30 percent had a greater healing effect, with an application frequency of every twelve hours, for a period of seven days.TesisEl objetivo del trabajo fue determinar el efecto cicatrizante de la crema a base del extracto lipídico de Chenopodium Quinoa willd (quinua roja Pasankalla) en ratones albinos con lesiones por heridas punzocortantes. La investigación es de tipo aplicado y de diseño experimental. Los granos de Chenopodium Quinoa willd son provenientes de la Universidad Nacional Agraria la Molina. Se determinó los metabolitos secundarios mediante la marcha fitoquímica empleando el extracto con éter de petróleo de Chenopodium Quinoa willd. Para la obtención del extracto lipídico se utilizó el método Soxhlet, determinando el contenido de aceite natural; la extracción se realizó con el solvente éter de petróleo a una temperatura entre los 30° – 40° C. Para la investigación farmacológica tópica, se preparó una crema base, a la que se le añadió concentraciones de extracto al 10, 20 y 30 por ciento y como referencia se utilizó sulfadiazina de plata (crema) al 1 por ciento. Se emplearon 30 ratones albinos machos de la cepa Mus Muculus, con 30 g +/- 5 g de peso divididas en 5 grupos. Se empleó la técnica de lesión inducida que consiste en la realización de un corte con una hoja de bisturí en la parte dorsal del ratón previamente depilado y se aplicó la crema en las diversas concentraciones. Al octavo día del procedimiento los ratones fueron sacrificados con pentobarbital sódico por vía intraperitoneal. Se utilizó el equipó dinamómetro (equipo de tensión con arena) para medir el cierre de herida, obteniéndose resultados favorables, los cuales fueron analizados mediante pruebas estadísticas: ANOVA y prueba de Tukey. Los resultados del estudio evidenciaron que el extracto con éter de petróleo de Chenopodium Quinoa willd contiene compuestos fenólicos, flavonoides, aminoácidos libres, aceites y grasas. Se demostró que la crema a base del extracto lipídico de Chenopodium Quinoa willd al 30 por ciento obtuvo mayor efecto cicatrizante, con una frecuencia de aplicación de cada doce horas, por un periodo de siete días. Por lo tanto, se concluye que la crema a base del extracto lipídico de Chenopodium Quinoa Willd tiene efecto cicatrizante

  • Efecto cicatrizante de la crema a base del extracto lipídico de Chenopodium Quinoa willd (quinua roja pasankalla) en ratones albinos con lesiones por heridas punzocortantes
    'Universidad Inca Garcilaso de la Vega', 2019
    Co-Authors: Montalvo Correa, Josselyn Naydu, Tomasto Bautista, Alejandro Daniel
    Abstract:

    El objetivo del trabajo fue determinar el efecto cicatrizante de la crema a base del extracto lipídico de Chenopodium Quinoa willd (quinua roja Pasankalla) en ratones albinos con lesiones por heridas punzocortantes. La investigación es de tipo aplicado y de diseño experimental. Los granos de Chenopodium Quinoa willd son provenientes de la Universidad Nacional Agraria la Molina. Se determinó los metabolitos secundarios mediante la marcha fitoquímica empleando el extracto con éter de petróleo de Chenopodium Quinoa willd. Para la obtención del extracto lipídico se utilizó el método Soxhlet, determinando el contenido de aceite natural; la extracción se realizó con el solvente éter de petróleo a una temperatura entre los 30° – 40° C. Para la investigación farmacológica tópica, se preparó una crema base, a la que se le añadió concentraciones de extracto al 10, 20 y 30 por ciento y como referencia se utilizó sulfadiazina de plata (crema) al 1 por ciento. Se emplearon 30 ratones albinos machos de la cepa Mus Muculus, con 30 g +/- 5 g de peso divididas en 5 grupos. Se empleó la técnica de lesión inducida que consiste en la realización de un corte con una hoja de bisturí en la parte dorsal del ratón previamente depilado y se aplicó la crema en las diversas concentraciones. Al octavo día del procedimiento los ratones fueron sacrificados con pentobarbital sódico por vía intraperitoneal. Se utilizó el equipó dinamómetro (equipo de tensión con arena) para medir el cierre de herida, obteniéndose resultados favorables, los cuales fueron analizados mediante pruebas estadísticas: ANOVA y prueba de Tukey. Los resultados del estudio evidenciaron que el extracto con éter de petróleo de Chenopodium Quinoa willd contiene compuestos fenólicos, flavonoides, aminoácidos libres, aceites y grasas. Se demostró que la crema a base del extracto lipídico de Chenopodium Quinoa willd al 30 por ciento obtuvo mayor efecto cicatrizante, con una frecuencia de aplicación de cada doce horas, por un periodo de siete días. Por lo tanto, se concluye que la crema a base del extracto lipídico de Chenopodium Quinoa Willd tiene efecto cicatrizante.The objective of the study was to determine the healing effect of the cream based on the lipid extract of Chenopodium Quinoa Willd (Red Quinua Pasankalla) in albino mice with puncture wound injuries. The research is of applied type and experimental design. The Chenopodium Quinoa Willd grains are from the Puno region and purchased from the National Institute of Agrarian Innovation (INIA). The secondary metabolites were determined by the phytochemical march using the extract with petroleum ether of Chenopodium Quinoa Willd. To obtain the lipid extract, the Soxhlet method was used, determining the natural oil content; the extraction was carried out with the petroleum ether solvent at a temperature between 30 ° - 40 ° C. For topical pharmacological research, a base cream was prepared, to which concentrations of extract at 10, 20 and 30 percent were added. and 1 percent silver sulfadiazine (cream) was used as a reference. It took 30 male albino mice of Mus Muculus strain, with 30 g +/- 5 g of weight divided into 5 groups, where the technique of induced injury was used, which consists of making a cut with a scalpel blade in the dorsal part of the mouse previously depilated and the cream was applied in the different concentrations. On the eighth day of the procedure, the mice were sacrificed with intraperitoneal sodium pentobarbital, the equipment was used (tension equipment with sand) to measure wound closure, obtaining favorable results, which were analyzed by statistical tests: ANOVA and test of Tukey. The results of the study showed that the petroleum ether extract of Chenopodium Quinoa Willd contains phenolic compounds, flavonoids, free amino acids, oils and fats. It was demonstrated that the cream based on the lipid extract of Chenopodium Quinoa Willd at 30 percent had a greater healing effect, with an application frequency of every twelve hours, for a period of seven days

Montalvo Correa, Josselyn Naydu - One of the best experts on this subject based on the ideXlab platform.

  • Efecto cicatrizante de la crema a base del extracto lipídico de Chenopodium Quinoa willd (quinua roja pasankalla) en ratones albinos con lesiones por heridas punzocortantes
    'Universidad Inca Garcilaso de la Vega', 2019
    Co-Authors: Montalvo Correa, Josselyn Naydu, Tomasto Bautista, Alejandro Daniel
    Abstract:

    The objective of the study was to determine the healing effect of the cream based on the lipid extract of Chenopodium Quinoa Willd (Red Quinua Pasankalla) in albino mice with puncture wound injuries. The research is of applied type and experimental design. The Chenopodium Quinoa Willd grains are from the Puno region and purchased from the National Institute of Agrarian Innovation (INIA). The secondary metabolites were determined by the phytochemical march using the extract with petroleum ether of Chenopodium Quinoa Willd. To obtain the lipid extract, the Soxhlet method was used, determining the natural oil content; the extraction was carried out with the petroleum ether solvent at a temperature between 30 ° - 40 ° C. For topical pharmacological research, a base cream was prepared, to which concentrations of extract at 10, 20 and 30 percent were added. and 1 percent silver sulfadiazine (cream) was used as a reference. It took 30 male albino mice of Mus Muculus strain, with 30 g +/- 5 g of weight divided into 5 groups, where the technique of induced injury was used, which consists of making a cut with a scalpel blade in the dorsal part of the mouse previously depilated and the cream was applied in the different concentrations. On the eighth day of the procedure, the mice were sacrificed with intraperitoneal sodium pentobarbital, the equipment was used (tension equipment with sand) to measure wound closure, obtaining favorable results, which were analyzed by statistical tests: ANOVA and test of Tukey. The results of the study showed that the petroleum ether extract of Chenopodium Quinoa Willd contains phenolic compounds, flavonoids, free amino acids, oils and fats. It was demonstrated that the cream based on the lipid extract of Chenopodium Quinoa Willd at 30 percent had a greater healing effect, with an application frequency of every twelve hours, for a period of seven days.TesisEl objetivo del trabajo fue determinar el efecto cicatrizante de la crema a base del extracto lipídico de Chenopodium Quinoa willd (quinua roja Pasankalla) en ratones albinos con lesiones por heridas punzocortantes. La investigación es de tipo aplicado y de diseño experimental. Los granos de Chenopodium Quinoa willd son provenientes de la Universidad Nacional Agraria la Molina. Se determinó los metabolitos secundarios mediante la marcha fitoquímica empleando el extracto con éter de petróleo de Chenopodium Quinoa willd. Para la obtención del extracto lipídico se utilizó el método Soxhlet, determinando el contenido de aceite natural; la extracción se realizó con el solvente éter de petróleo a una temperatura entre los 30° – 40° C. Para la investigación farmacológica tópica, se preparó una crema base, a la que se le añadió concentraciones de extracto al 10, 20 y 30 por ciento y como referencia se utilizó sulfadiazina de plata (crema) al 1 por ciento. Se emplearon 30 ratones albinos machos de la cepa Mus Muculus, con 30 g +/- 5 g de peso divididas en 5 grupos. Se empleó la técnica de lesión inducida que consiste en la realización de un corte con una hoja de bisturí en la parte dorsal del ratón previamente depilado y se aplicó la crema en las diversas concentraciones. Al octavo día del procedimiento los ratones fueron sacrificados con pentobarbital sódico por vía intraperitoneal. Se utilizó el equipó dinamómetro (equipo de tensión con arena) para medir el cierre de herida, obteniéndose resultados favorables, los cuales fueron analizados mediante pruebas estadísticas: ANOVA y prueba de Tukey. Los resultados del estudio evidenciaron que el extracto con éter de petróleo de Chenopodium Quinoa willd contiene compuestos fenólicos, flavonoides, aminoácidos libres, aceites y grasas. Se demostró que la crema a base del extracto lipídico de Chenopodium Quinoa willd al 30 por ciento obtuvo mayor efecto cicatrizante, con una frecuencia de aplicación de cada doce horas, por un periodo de siete días. Por lo tanto, se concluye que la crema a base del extracto lipídico de Chenopodium Quinoa Willd tiene efecto cicatrizante

  • Efecto cicatrizante de la crema a base del extracto lipídico de Chenopodium Quinoa willd (quinua roja pasankalla) en ratones albinos con lesiones por heridas punzocortantes
    'Universidad Inca Garcilaso de la Vega', 2019
    Co-Authors: Montalvo Correa, Josselyn Naydu, Tomasto Bautista, Alejandro Daniel
    Abstract:

    El objetivo del trabajo fue determinar el efecto cicatrizante de la crema a base del extracto lipídico de Chenopodium Quinoa willd (quinua roja Pasankalla) en ratones albinos con lesiones por heridas punzocortantes. La investigación es de tipo aplicado y de diseño experimental. Los granos de Chenopodium Quinoa willd son provenientes de la Universidad Nacional Agraria la Molina. Se determinó los metabolitos secundarios mediante la marcha fitoquímica empleando el extracto con éter de petróleo de Chenopodium Quinoa willd. Para la obtención del extracto lipídico se utilizó el método Soxhlet, determinando el contenido de aceite natural; la extracción se realizó con el solvente éter de petróleo a una temperatura entre los 30° – 40° C. Para la investigación farmacológica tópica, se preparó una crema base, a la que se le añadió concentraciones de extracto al 10, 20 y 30 por ciento y como referencia se utilizó sulfadiazina de plata (crema) al 1 por ciento. Se emplearon 30 ratones albinos machos de la cepa Mus Muculus, con 30 g +/- 5 g de peso divididas en 5 grupos. Se empleó la técnica de lesión inducida que consiste en la realización de un corte con una hoja de bisturí en la parte dorsal del ratón previamente depilado y se aplicó la crema en las diversas concentraciones. Al octavo día del procedimiento los ratones fueron sacrificados con pentobarbital sódico por vía intraperitoneal. Se utilizó el equipó dinamómetro (equipo de tensión con arena) para medir el cierre de herida, obteniéndose resultados favorables, los cuales fueron analizados mediante pruebas estadísticas: ANOVA y prueba de Tukey. Los resultados del estudio evidenciaron que el extracto con éter de petróleo de Chenopodium Quinoa willd contiene compuestos fenólicos, flavonoides, aminoácidos libres, aceites y grasas. Se demostró que la crema a base del extracto lipídico de Chenopodium Quinoa willd al 30 por ciento obtuvo mayor efecto cicatrizante, con una frecuencia de aplicación de cada doce horas, por un periodo de siete días. Por lo tanto, se concluye que la crema a base del extracto lipídico de Chenopodium Quinoa Willd tiene efecto cicatrizante.The objective of the study was to determine the healing effect of the cream based on the lipid extract of Chenopodium Quinoa Willd (Red Quinua Pasankalla) in albino mice with puncture wound injuries. The research is of applied type and experimental design. The Chenopodium Quinoa Willd grains are from the Puno region and purchased from the National Institute of Agrarian Innovation (INIA). The secondary metabolites were determined by the phytochemical march using the extract with petroleum ether of Chenopodium Quinoa Willd. To obtain the lipid extract, the Soxhlet method was used, determining the natural oil content; the extraction was carried out with the petroleum ether solvent at a temperature between 30 ° - 40 ° C. For topical pharmacological research, a base cream was prepared, to which concentrations of extract at 10, 20 and 30 percent were added. and 1 percent silver sulfadiazine (cream) was used as a reference. It took 30 male albino mice of Mus Muculus strain, with 30 g +/- 5 g of weight divided into 5 groups, where the technique of induced injury was used, which consists of making a cut with a scalpel blade in the dorsal part of the mouse previously depilated and the cream was applied in the different concentrations. On the eighth day of the procedure, the mice were sacrificed with intraperitoneal sodium pentobarbital, the equipment was used (tension equipment with sand) to measure wound closure, obtaining favorable results, which were analyzed by statistical tests: ANOVA and test of Tukey. The results of the study showed that the petroleum ether extract of Chenopodium Quinoa Willd contains phenolic compounds, flavonoids, free amino acids, oils and fats. It was demonstrated that the cream based on the lipid extract of Chenopodium Quinoa Willd at 30 percent had a greater healing effect, with an application frequency of every twelve hours, for a period of seven days

Pirjo Mattila - One of the best experts on this subject based on the ideXlab platform.

  • flavonoids and other phenolic compounds in andean indigenous grains Quinoa Chenopodium Quinoa kaniwa Chenopodium pallidicaule and kiwicha amaranthus caudatus
    Food Chemistry, 2010
    Co-Authors: Ritva Repocarrascovalencia, Jarkko Hellstrom, Juhamatti Pihlava, Pirjo Mattila
    Abstract:

    Abstract The amount of phenolic acids, flavonoids and betalains in Andean indigenous grains, Quinoa ( Chenopodium Quinoa ), kaniwa ( Chenopodium pallidicaule ) and kiwicha ( Amaranthus caudatus ), was determined. The total amount of phenolic acids varied from 16.8 to 59.7 mg/100 g and the proportion of soluble phenolic acids varied from 7% to 61%. The phenolic acid content in Andean crops was low compared with common cereals like wheat and rye, but was similar to levels found in oat, barley, corn and rice. The flavonoid content of Quinoa and kaniwa was exceptionally high, varying from 36.2 to 144.3 mg/100 g. Kiwicha did not contain quantifiable amounts of these compounds. Only one variety of kiwicha contained low amounts of betalains. These compounds were not detected in kaniwa or Quinoa. Our study demonstrates that Andean indigenous crops have excellent potential as sources of health-promoting bioactive compounds such as flavonoids.

Guangfu Liu - One of the best experts on this subject based on the ideXlab platform.

  • occurrence of Chenopodium Quinoa mitovirus 1 in Chenopodium Quinoa in china
    Plant Disease, 2021
    Co-Authors: Kai Sun, Feijun Fan, Pengjun Zhang, Guangfu Liu
    Abstract:

    Chenopodium Quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium Quinoa including Cherry vanilla Quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. Quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Galvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. Quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. Quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5'- TCCGAATCTCATTTTCGGAGTGGGTAGA -3' and P1R: 5'- CAGACTTTAGATCAAATGAATACACATGT -3'; P2F: 5'- TCCAGTATACCTGTGGATAGTACTTTCA -3'and P2R: 5'- CGATCTCTGCTACCAAATACTCGTGAGCC -3') to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. Quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. Quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. Quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. Quinoa raises a serious concern for the local C. Quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

Ritva Repocarrascovalencia - One of the best experts on this subject based on the ideXlab platform.

  • flavonoids and other phenolic compounds in andean indigenous grains Quinoa Chenopodium Quinoa kaniwa Chenopodium pallidicaule and kiwicha amaranthus caudatus
    Food Chemistry, 2010
    Co-Authors: Ritva Repocarrascovalencia, Jarkko Hellstrom, Juhamatti Pihlava, Pirjo Mattila
    Abstract:

    Abstract The amount of phenolic acids, flavonoids and betalains in Andean indigenous grains, Quinoa ( Chenopodium Quinoa ), kaniwa ( Chenopodium pallidicaule ) and kiwicha ( Amaranthus caudatus ), was determined. The total amount of phenolic acids varied from 16.8 to 59.7 mg/100 g and the proportion of soluble phenolic acids varied from 7% to 61%. The phenolic acid content in Andean crops was low compared with common cereals like wheat and rye, but was similar to levels found in oat, barley, corn and rice. The flavonoid content of Quinoa and kaniwa was exceptionally high, varying from 36.2 to 144.3 mg/100 g. Kiwicha did not contain quantifiable amounts of these compounds. Only one variety of kiwicha contained low amounts of betalains. These compounds were not detected in kaniwa or Quinoa. Our study demonstrates that Andean indigenous crops have excellent potential as sources of health-promoting bioactive compounds such as flavonoids.