The Experts below are selected from a list of 156 Experts worldwide ranked by ideXlab platform
Linda I Hannick - One of the best experts on this subject based on the ideXlab platform.
-
transcriptomic study reveals widespread spliced leader trans splicing short 5 utrs and potential complex carbon fixation mechanisms in the euglenoid alga Eutreptiella sp
PLOS ONE, 2013Co-Authors: Huan Zhang, Yunyun Zhuang, Linda I HannickAbstract:Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
-
Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.
PLOS ONE, 2013Co-Authors: Huan Zhang, Yunyun Zhuang, Linda I HannickAbstract:Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
M. L. Villarino - One of the best experts on this subject based on the ideXlab platform.
-
Diel migration of phytoplankton and spectral light field in the Ría de Vigo (NW Spain)
Marine Biology, 1998Co-Authors: F. L. Figueroa, F. G. Figueiras, F. X. Niell, M. L. VillarinoAbstract:Diel migration of Mesodinium rubrum , Eutreptiella sp., Scrippsiella trochoidea , Dinophysis acuminata and Ceratium furca throughout a 24 h cycle is described for a stable, well-stratified estuary (Ría de Vigo, NW Spain). Daily changes in light quantity and in spectral light ratios i.e. red:far-red, blue:red, green:red and blue:green have been analysed. The spectral light ratios changed at twilight and around noon at various depths. Some of the downward migrations were well predicted by Stokes' law, while other migrations were faster and deeper than calculated. The coincidence of these movements with abrupt changes in red:far-red, green:red and blue:green light ratios is discussed. Some species are able to migrate through the pycnocline, whereas others do not seem to be able to do so. Several species are present in maximum numbers at depth at night, while others display upward migration independent of light, suggesting the existence of endogenous rhythms. Upward migration at dusk began with dispersal of populations, with renewed aggregation at the sea surface coincident with an increase in the red:far-red ratio at 6 m and the green:red ratio at 6 and 10 m. Based on direct evidence for the control of flagellar mobility by light quality reported by other authors from laboratory studies, it is suggested that, together with other cues, spectral light ratios of different light qualities modulate vertical phytoplanktonic migration.
-
Evidence of in situ diel vertical migration of a red-tide microplankton species in Ría de Vigo (NW Spain)
Marine Biology, 1995Co-Authors: M. L. Villarino, F. G. Figueiras, K. J. Jones, X. A. Alvarez-salgado, J. Richard, A. EdwardsAbstract:The migration capacity of red-tide species in the natural environment was studied at a station in the Ría de Vigo (Rías Bajas, NW Spain) over a 24 h period in September 1991. The Ría de Vigo, where red tides are frequent, normally shows a positive estuarine circulation and is subjected to seasonal upwelling and downwelling phenomena. A marked diel pattern was observed for five species that are capable of causing red tides ( Ceratium furca, Scrippsiella trochoidea, Dinophysis acuminata, Mesodinium rubrum , and Eutreptiella sp.). Such diel behaviour could be clearly advantageous in a stratified environment where light and nutrients are often in two separate layers. Active movement enables species such as dinoflagellates and some ciliates to exploit high levels of irradiance at the surface during the day and to take up nutrients in deeper layers at night. Patchy distribution of phytoplankton, shear-induced horizontal dispersion and density variations were considered, but none of them accounted for the vertical changes observed. Vertical migration is thought to be one of the mechanisms that could promote blooms in nutrient-depleted surface layers.
Huan Zhang - One of the best experts on this subject based on the ideXlab platform.
-
transcriptomic study reveals widespread spliced leader trans splicing short 5 utrs and potential complex carbon fixation mechanisms in the euglenoid alga Eutreptiella sp
PLOS ONE, 2013Co-Authors: Huan Zhang, Yunyun Zhuang, Linda I HannickAbstract:Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
-
Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.
PLOS ONE, 2013Co-Authors: Huan Zhang, Yunyun Zhuang, Linda I HannickAbstract:Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
Yunyun Zhuang - One of the best experts on this subject based on the ideXlab platform.
-
transcriptomic study reveals widespread spliced leader trans splicing short 5 utrs and potential complex carbon fixation mechanisms in the euglenoid alga Eutreptiella sp
PLOS ONE, 2013Co-Authors: Huan Zhang, Yunyun Zhuang, Linda I HannickAbstract:Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
-
Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.
PLOS ONE, 2013Co-Authors: Huan Zhang, Yunyun Zhuang, Linda I HannickAbstract:Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.
F. G. Figueiras - One of the best experts on this subject based on the ideXlab platform.
-
Diel migration of phytoplankton and spectral light field in the Ría de Vigo (NW Spain)
Marine Biology, 1998Co-Authors: F. L. Figueroa, F. G. Figueiras, F. X. Niell, M. L. VillarinoAbstract:Diel migration of Mesodinium rubrum , Eutreptiella sp., Scrippsiella trochoidea , Dinophysis acuminata and Ceratium furca throughout a 24 h cycle is described for a stable, well-stratified estuary (Ría de Vigo, NW Spain). Daily changes in light quantity and in spectral light ratios i.e. red:far-red, blue:red, green:red and blue:green have been analysed. The spectral light ratios changed at twilight and around noon at various depths. Some of the downward migrations were well predicted by Stokes' law, while other migrations were faster and deeper than calculated. The coincidence of these movements with abrupt changes in red:far-red, green:red and blue:green light ratios is discussed. Some species are able to migrate through the pycnocline, whereas others do not seem to be able to do so. Several species are present in maximum numbers at depth at night, while others display upward migration independent of light, suggesting the existence of endogenous rhythms. Upward migration at dusk began with dispersal of populations, with renewed aggregation at the sea surface coincident with an increase in the red:far-red ratio at 6 m and the green:red ratio at 6 and 10 m. Based on direct evidence for the control of flagellar mobility by light quality reported by other authors from laboratory studies, it is suggested that, together with other cues, spectral light ratios of different light qualities modulate vertical phytoplanktonic migration.
-
Evidence of in situ diel vertical migration of a red-tide microplankton species in Ría de Vigo (NW Spain)
Marine Biology, 1995Co-Authors: M. L. Villarino, F. G. Figueiras, K. J. Jones, X. A. Alvarez-salgado, J. Richard, A. EdwardsAbstract:The migration capacity of red-tide species in the natural environment was studied at a station in the Ría de Vigo (Rías Bajas, NW Spain) over a 24 h period in September 1991. The Ría de Vigo, where red tides are frequent, normally shows a positive estuarine circulation and is subjected to seasonal upwelling and downwelling phenomena. A marked diel pattern was observed for five species that are capable of causing red tides ( Ceratium furca, Scrippsiella trochoidea, Dinophysis acuminata, Mesodinium rubrum , and Eutreptiella sp.). Such diel behaviour could be clearly advantageous in a stratified environment where light and nutrients are often in two separate layers. Active movement enables species such as dinoflagellates and some ciliates to exploit high levels of irradiance at the surface during the day and to take up nutrients in deeper layers at night. Patchy distribution of phytoplankton, shear-induced horizontal dispersion and density variations were considered, but none of them accounted for the vertical changes observed. Vertical migration is thought to be one of the mechanisms that could promote blooms in nutrient-depleted surface layers.
