The Experts below are selected from a list of 96765 Experts worldwide ranked by ideXlab platform

Stylianos E Antonarakis - One of the best experts on this subject based on the ideXlab platform.

  • clinical cytogenetic and molecular evaluation of a patient with partial trisomy 21 21q11 q22 lacking the classical down syndrome phenotype
    2005
    Co-Authors: A Charles M D Williams, Stylianos E Antonarakis, Jaime L Frias, Mary Kay Mccormick, Eduardo S Cantu
    Abstract:

    The clinical, cytogenetic, and molecular studies of an individual are presented here for the purpose of further characterizing what regions of Chromosome 21q are essential for expression of the typical Down syndrome phenotype. This individual had a de novo, unbalanced translocation Chromosome interpreted as: 45,XX,t(18;dup[21q]). Physical examination revealed mild manifestations, but not the typical phenotype of Down syndrome. The patient was studied using 20 single copy probes known to map to the 21q region. DNA polymorphism and dosage analyses showed triplication of loci D21S13 through D21S58 involving 21q11 to 21q22.1, and possibly involving the 21q22.2 region. Her clinical presentation, which did not include the classical findings of Down syndrome, suggests that regions distal to 21q22.1, when present in triplicate dose, account for the major manifestations of the classical phenotype. However, duplication of the area between the centromere and 21q22.1 may contribute to some of the other abnormalities in Down syndrome.

  • a narcolepsy susceptibility locus maps to a 5mb region of Chromosome 21q
    2004
    Co-Authors: Yves Dauvilliers, Jeanlouis Blouin, Stylianos E Antonarakis, Elisabeth Neidhart, Bertrand Carlander, Jeanfrancois Eliaou, Michel Billiard, Mehdi Tafti
    Abstract:

    The genetic basis of human narcolepsy remains poorly understood. Multiplex families with full-blown narcolepsy-cataplexy are rare, whereas families with both narcolepsy-cataplexy and excessive daytime sleepiness without cataplexy are more common. We performed a genomewide linkage analysis in a large French family with four members affected with narcolepsy-cataplexy and 10 others with isolated recurrent naps or lapses into sleep. Only three regions showed logarithm of odds (LOD) scores greater than 1 in two-point linkage analysis (D6S1960, D11S2359, and D21S228). Genotyping additional markers provided support for linkage to 9 markers on Chromosome 21 (maximum two-point LOD score, 3.36 at D21S1245). The multipoint linkage analysis using SimWalk2 provided further evidence for linkage to the same region (maximum parametric LOD score, 4.00 at 21GT26K). A single haplotype was shared by all affected individuals and informative crossovers indicated that the elusive gene that confers susceptibility to narcolepsy is likely to be located between markers D21S267 and ABCG1, in a 5.15 Mb region of 21q.

  • a csnp map and database for human Chromosome 21
    2001
    Co-Authors: Samuel Deutsch, Stylianos E Antonarakis, Christian Iseli, Philipp Bucher, Hamish S Scott
    Abstract:

    Single nucleotide polymorphisms (SNPs) are likely to contribute to the study of complex genetic diseases. The genomic sequence of human Chromosome 21q was recently completed with 225 annotated genes, thus permitting efficient identification and precise mapping of potential cSNPs by bioinformatics approaches. Here we present a human Chromosome 21 (HC21) cSNP database and the first Chromosome-specific cSNP map. Potential cSNPs were generated using three approaches: (1) Alignment of the complete HC21 genomic sequence to cognate ESTs and mRNAs. Candidate cSNPs were automatically extracted using a novel program for context-dependent SNP identification that efficiently discriminates between true variation, poor quality sequencing, and paralogous gene alignments. (2) Multiple alignment of all known HC21 genes to all other human database entries. (3) Gene-targeted cSNP discovery. To date we have identified 377 cSNPs averaging ~1 SNP per 1.5 kb of transcribed sequence, covering 65% of known genes in the Chromosome. Validation of our bioinformatics approach was demonstrated by a confirmation rate of 78% for the predicted cSNPs, and in total 32% of the cSNPs in our database have been confirmed. The database is publicly available at http://csnp.unige.ch or http://csnp.isb-sib.ch. These SNPs provide a tool to study the contribution of HC21 loci to complex diseases such as bipolar affective disorder and allele-specific contributions to Down syndrome phenotypes.

  • patterns of meiotic recombination on the long arm of human Chromosome 21
    2000
    Co-Authors: Audrey Lynn, Stylianos E Antonarakis, Michael B Petersen, Carl S Kashuk, Jeffrey A Bailey, Aravinda Chakravarti
    Abstract:

    In this study we quantify the features of meiotic recombination on the long arm of human Chromosome 21. We constructed a 67. 3-centimorgan (cM) high-resolution, comprehensive, and accurate genetic linkage map of Chromosome 21q using 187 highly polymorphic markers covering almost the entire long arm; 46 loci, consisting of mutually recombining marker sets, were ordered with greater than 1000:1 odds and with average interlocus distance of 1.46 cM. These markers were used to accurately identify all exchanges in 186 female and 160 male meioses and to show (1) significant excess of recombination in female versus male meioses, (2) an overall decline in female:male recombination between the centromere and the telomere, (3) greater positive chiasma interference in male than in female meioses, and (4) lack of correlation between exchange frequency and parental age. By comparing the genetic map with the 21q sequence map, we show a general trend of increasing male, but near-constant female, recombination versus physical distance across 21q, explaining the gender-specific recombination effect. The recombination rate varies considerably between genders across 21q but is the greatest (eightfold) in the pericentromeric region, with a rate of approximately 250 kb/cM in females and approximately 2125 kb/cM in males. We used information on the locations of all exchanges to construct an empirical map function that confirms the statistical findings of positive interference. These analyses reveal that occurrence of recombination on 21q is not only gender-specific but also region-specific and that recombination suppression at the centromere is not universal. We also find evidence that male exchange location is highly correlated with gene density.

  • a new dinucleotide repeat polymorphism at the telomere of Chromosome 21q reveals a significant difference between male and female rates of recombination
    1995
    Co-Authors: Jeanlouis Blouin, D H Christie, Arnaud Gos, A Lynn, Michael A Morris, D H Ledbetter, Aravinda Chakravarti, Stylianos E Antonarakis
    Abstract:

    We have used a half-YAC containing the human Chromosome 21 long-arm telomere to clone, map, and characterize a new dinucleotide repeat polymorphism (D21S1575) close to 21qter. This marker is < 120 kb from the telomeric (TTAGGG)n sequences and is the most distal highly polymorphic marker on Chromosome 21q. This marker has a heterozygosity of 71% because of a variable (TA)n repeat embedded within a long interspersed element (LINE) element. Genotyping of the CEPH families and linkage analysis provided a more accurate determination of the full length of the Chromosome 21 genetic map. A highly significant difference was detected between male and female recombination rates in the telomeric region: in the most telomeric 2.3 Mb of Chromosome 21q, recombination was only observed in male meioses.

Sidney Pestka - One of the best experts on this subject based on the ideXlab platform.

  • Allele
    2016
    Co-Authors: Sidney Pestka, V. Jung, Chad Nusbaum, D. Patterso
    Abstract:

    Source/Description: Cosmids harboring dinucleotide repeats were identified by hybridization of 32P-labelled poly(dG- dT) to a dot blot of 216 human cosmid clones derived from the Chromosome 21q somatic cell hybrid 3xls (1). Cosmid 4.47 was subcloned into pBluescript SK(+) and a (dC-dA) repeat-containing clone was identified and sequenced. Two GT dinucleotide repeats were identified within this 491 nt Sau3AI genomic clone. DB-3: A GT dinucleotide repeat 11 units in length was identified, and PCR primers were synthesized for amplification of a predicted 150 nt product containing the (dG-dT) segment. DB-4: A complex GT dinucleotide repeat with the structure (CT)4TT(CT)3TT(C-T)2TT(CT)5TT(GT)i3 was identified, and PCR primers were synthesized for amplification of a predicted 164 nt product containing this segment (EMBL accession no. Z12142). Primer Sequences: DB-3 GATACTCAGAATGACTCACC (CA strand) TCTGTTTTCAGCCTCTGCA (GT strand) DB-4 TTTGTGCCACTGCACTCCAG (CA strand) GGTGAGTCATTCTGAGTATC (GT strand

  • Sublocalization of the human interferon-gamma receptor accessory factor gene and characterization of accessory factor activity by yeast artificial chromosomal fragmentation.
    1994
    Co-Authors: Jeffry R. Cook, Stuart L. Emanuel, Barbara Schwartz, S Rhee, Robert J. Donnelly, Thomas M Mariano, Sidney Pestka
    Abstract:

    Abstract A chromosomal fragmentation procedure was employed to produce a deletion set of yeast artificial Chromosomes (YACs) from a parental YAC, GART D142H8, known to map to human Chromosome 21q and to encode the human interferon-gamma receptor (Hu-IFN-gamma R) accessory factor gene as well as the phosphoribosylglycinamide formyltransferase (GART) gene. When expressed in Chinese hamster ovary cells, these deleted YACs retain accessory factor activity, as judged by major histocompatibility complex class I antigen inducibility, until the deletions from the acentric end exceed 390 kilobases (kb). Therefore, the accessory factor (AF-1) gene can be localized to a 150-kb region at the left (centric) end of the parental 540-kb GART YAC. Cells containing functional YACs are also able to induce the ISGF3 gamma and gamma-activated factor (GAF) transcription factors, but were not protected against encephalomyocarditis virus (EMCV) upon treatment with Hu-IFN-gamma. Therefore, the Hu-IFN-gamma R and the AF-1 are sufficient for some, but not all, of the actions of Hu-IFN-gamma. We postulate that an additional accessory factor (AF-2) required for antiviral activity against EMCV is encoded on Chromosome 21q.

Ilya Chumakov - One of the best experts on this subject based on the ideXlab platform.

  • a high fidelity physical map of human Chromosome 21q in yeast artificial Chromosomes
    1995
    Co-Authors: Julie R Korenberg, Xufeng Chen, Steve Chappell Mitchell, S Fannin, S Gerwehr, D Cohen, Ilya Chumakov
    Abstract:

    Understanding of the human genome has been advanced significantly by the development of large DNA fragment libraries. To create a map of Chromosome 21q that integrates the physical, cytogenetic, and linkage maps, we have characterized a subset of 127 Chromosome 21 yeast artificial Chromosome (YAC) clones for size, by pulsed field gel electrophoresis, for chimerism and cytogenetic location, by fluorescence in situ hybridization (FISH), and for sequence-tagged sites (STS) content, by PCR. It was found that 54% generated unique map locations on Chromosome 21, and 45% detected sites on other Chromosomes, of which 33% likely represented true chimerism. Using a simple algorithm, the data from nonchimeric clones have been combined to generate a size-corrected minimal tiling pathway including 58 Chromosome 21q YACs that represent approximately 33 Mb and include 9 gaps. To confirm the resulting order and relationship to the cytogenetic map, the breakpoints from 23 cell lines partially aneuploid for Chromosome 21 have been analyzed by quantitative Southern blot dosage analysis and FISH with a subset of the markers. As one way of investigating the relationship of the genetic to the physical map, the genetic map was superimposed on the physical map using a subset of well-defined markers common to both. The results suggest potential hot spots for recombination and/or gaps in the physical map. This integrated map will facilitate the search for the genes responsible for the Down syndrome phenotypes and provide a better understanding of genome organization and Chromosome structure.

  • YAC analysis and minimal tiling path construction for Chromosome 21q
    1995
    Co-Authors: Katheleen Gardiner, Sharon Graw, Hitoshi Ichikawa, Misao Ohki, Anthony Joetham, Partricia Gervy, Ilya Chumakov, David Patterson
    Abstract:

    We have undertaken a detailed analysis of several hundred YACs from widely available YAC libraries which map to human Chromosome 21 with the goal of improving the physical map of Chromosome 21 and determining the feasibility of producing a minimal tiling path of well characterized, stable, non-chimeric YACs spanning the long arm of the Chromosome (21q). We report information on over 500 YACs known to contain STS from 21q including information on size, stability, chimerism, marker content, and NotI restriction sites. YACs derive from the CEPH and St. Louis YAC libraries, and STSs include the set of 198 markers originally used do assemble a YAC contig of 21q, as well as additional anonymous probes and gene markers. This information has assisted in refinements of STS order, has defined a region of general instability in 21q22.3, has identified an increased number of NotI restriction sites, and has defined cryptic gaps, particularly in 21q21, for which few or no markers are available. These results have allowed us to develop and assess a minimal tiling path of overlapping YACs consisting of 59 YACs (and two P1 clones), largely non chimeric, stable, and of verified STS content. They total 30 mb of non-overlapping DNA, and contain all Chromosome 21 specific STSs originally used to define the 810 YAC 21q YAC contig. When integrated with the analysis of a somatic cell hybrid mapping panel of Chromosome 21 reported in the accompanying manuscript, a greatly enhanced understanding of the physical map of Chromosome 21 is obtained.

  • continuum of overlapping clones spanning the entire human Chromosome 21q
    1992
    Co-Authors: Ilya Chumakov, Philippe Rigault, Sophie Guillou, Pierre Ougen, Alain Billaut, Ghislaine Guasconi, Patricia Gervy, Isabelle Legall, Pascal Soularue, Laurent Grinas
    Abstract:

    A continuous array of overlapping clones covering the entire human Chromosome 21q was constructed from human yeast artificial Chromosome libraries using sequence-tagged sites as landmarks specifically detected by polymerase chain reaction. The yeast artificial Chromosome contiguous unit starts with pericentromeric and ends with subtelomeric loci of 21q. The resulting order of sequence-tagged sites is consistent with other physical and genetic mapping data. This set of overlapping clones will promote our knowledge of the structure of this Chromosome and the function of its genes.

Jeffry R. Cook - One of the best experts on this subject based on the ideXlab platform.

  • Sublocalization of the human interferon-gamma receptor accessory factor gene and characterization of accessory factor activity by yeast artificial chromosomal fragmentation.
    1994
    Co-Authors: Jeffry R. Cook, Stuart L. Emanuel, Barbara Schwartz, S Rhee, Robert J. Donnelly, Thomas M Mariano, Sidney Pestka
    Abstract:

    Abstract A chromosomal fragmentation procedure was employed to produce a deletion set of yeast artificial Chromosomes (YACs) from a parental YAC, GART D142H8, known to map to human Chromosome 21q and to encode the human interferon-gamma receptor (Hu-IFN-gamma R) accessory factor gene as well as the phosphoribosylglycinamide formyltransferase (GART) gene. When expressed in Chinese hamster ovary cells, these deleted YACs retain accessory factor activity, as judged by major histocompatibility complex class I antigen inducibility, until the deletions from the acentric end exceed 390 kilobases (kb). Therefore, the accessory factor (AF-1) gene can be localized to a 150-kb region at the left (centric) end of the parental 540-kb GART YAC. Cells containing functional YACs are also able to induce the ISGF3 gamma and gamma-activated factor (GAF) transcription factors, but were not protected against encephalomyocarditis virus (EMCV) upon treatment with Hu-IFN-gamma. Therefore, the Hu-IFN-gamma R and the AF-1 are sufficient for some, but not all, of the actions of Hu-IFN-gamma. We postulate that an additional accessory factor (AF-2) required for antiviral activity against EMCV is encoded on Chromosome 21q.

Takashi Ito - One of the best experts on this subject based on the ideXlab platform.

  • highly efficient pcr assay to discriminate allelic dna methylation status using whole genome amplification
    2011
    Co-Authors: Yoichi Yamada, Takashi Ito
    Abstract:

    Background: We previously developed a simple method termed HpaII-McrBC PCR (HM-PCR) to discriminate allelic methylation status of the genomic sites of interest, and successfully applied it to a comprehensive analysis of CpG islands (CGIs) on human Chromosome 21q. However, HM-PCR requires 200 ng of genomic DNA to examine one target site, thereby precluding its application to such samples that are limited in quantity. Findings: We developed HpaII-McrBC whole-genome-amplification PCR (HM-WGA-PCR) that uses whole-genomeamplified DNA as the template. HM-WGA-PCR uses only 1/100th the genomic template material required for HMPCR. Indeed, we successfully analyzed 147 CGIs by HM-WGA-PCR using only ~300 ng of DNA, whereas previous HM-PCR study had required ~30 μg. Furthermore, we confirmed that allelic methylation status revealed by HMWGA-PCR is identical to that by HM-PCR in every case of the 147 CGIs tested, proving high consistency between the two methods. Conclusions: HM-WGA-PCR would serve as a reliable alternative to HM-PCR in the analysis of allelic methylation status when the quantity of DNA available is limited.

  • a comprehensive analysis of allelic methylation status of cpg islands on human Chromosome 21q
    2004
    Co-Authors: Yoichi Yamada, Hidenobu Soejima, Michiko Uchiyama, Tsuyoshi Iwasaka, Tsunehiro Mukai, Yoshiyuki Sakaki, Hidemi Watanabe, Fumihito Miura, Takashi Ito
    Abstract:

    Mammalian genomes contain CpG dinucleotides much less frequently than expected from their GC contents (i.e., CpG suppression), and most of them are modified by methylation at the 5-position of cytosine (Ponger et al. 2001). However, CpG suppression is not observed or much less evident in characteristic regions termed CpG islands (CGIs) despite their high GC contents (Gardiner-Garden and Frommer 1987; Antequera and Bird 1993). CGIs are generally found near promoter regions of genes, including most housekeeping and many tissue-specific ones, and intriguingly escape methylation, often regardless of the expression of flanking genes (Macleod et al. 1998; Grunau et al. 2000; Ioshikhes and Zhang 2000). Although aberrant methylation of CGIs is frequently observed in cancer cells, some exceptional CGIs are physiologically methylated in an allele-specific manner. It is well known that one of the two X-Chromosomes in females is inactivated. The CGIs on the inactivated X-Chromosome are heavily methylated, similar to other regions on this Chromosome (Norris et al. 1991). On autosomes, a small number of imprinted genes that display exclusive or highly skewed expression of specific allele depending on their parental origins (Morison and Reeve 1998) have been demonstrated to accompany regions subject to parental-origin-dependent methylation. These regions are termed allelic differentially methylated regions (DMRs), and have been demonstrated to play pivotal roles in genomic imprinting (Wutz et al. 1997; Yoon et al. 2002). Although allelic DMRs show base composition similar to CGIs and often contain tandem repeat sequences (Neumann et al. 1995), they share no apparent sequence similarity. Allelic DMRs have been extensively searched around imprinted genes but not in other regions. In other words, their distribution has not been analyzed in an unbiased, hypothesis-free manner. Although several methods have been developed for the purpose, they are not truly comprehensive and have missed many DMRs (Plass et al. 1996). We thus intended to thoroughly examine the methylation status of CGIs based on the established genome sequence data, which allows one to identify all CGIs in silico. The experimental method to be used for the evaluation of methylation status should not only be rapid and simple but also be capable of detecting the coexistence of methylated and unmethylated alleles (i.e., composite methylation). As a method to fulfill the requirement, we developed a simple method called HpaII-McrBC PCR, which is based on the complementary sensitivity of the two enzymes HpaII and McrBC to DNA methylation. We applied it for the analysis of 149 CGIs computationally identified on human Chromosome 21q, one of the most completely sequenced Chromosomes. The analysis, which is the very first thorough analysis of CGIs on a Chromosome-wide scale, revealed an unexpectedly high incidence of normally methylated CGIs and, furthermore, three allelic DMRs, including one subject to a novel mode of allelic methylation.