The Experts below are selected from a list of 15207 Experts worldwide ranked by ideXlab platform
Stephen Ellis - One of the best experts on this subject based on the ideXlab platform.
-
west africa s international Drug Trade
Social Science Research Network, 2009Co-Authors: Stephen EllisAbstract:Since the publication in 2007 of a report on West Africa's role in the illegal cocaine Trade from Latin America to Europe, considerable media attention has focused on Guinea-Bissau in particular as a country infiltrated by Drug interests. However, West Africa has a long history of involvement in the international Drug Trade, that has been dominated by Nigerian interests especially. Consideration of this history may help stimulate a debate in historical sociology that will illuminate both the nature of involvement in the Drug Trade itself, and also larger questions about the long-term formation of the state.
-
west africa s international Drug Trade
African Affairs, 2009Co-Authors: Stephen EllisAbstract:Since the publication in 2007 of a report on West Africa's role in the illegal cocaine Trade from Latin America to Europe, considerable media attention has focused on Guinea-Bissau in particular as a country infiltrated by Drug interests. However, West Africa has a long history of involvement in the international Drug Trade, that has been dominated by Nigerian interests especially. Consideration of this history may help stimulate a debate in historical sociology that will illuminate both the nature of involvement in the Drug Trade itself, and also larger questions about the long-term formation of the state. © The Author [2009]. Published by Oxford University Press on behalf of Royal African Society. All rights reserved.
Nektarios Leontiadis - One of the best experts on this subject based on the ideXlab platform.
-
scripting the crime commission process in the illicit online prescription Drug Trade
Journal of Cybersecurity, 2015Co-Authors: Nektarios Leontiadis, Alice HutchingsAbstract:This article considers the processes in the illicit online prescription Drug Trade, namely search-redirection attacks and the operation of unlicensed pharmacies using crime script analysis. Empirical data have been used to describe the salient elements of the online criminal infrastructures and associated monetization paths enabling criminal profitability. This analysis reveals the existence of structural chokepoints: components of online criminal operations being limited in number, and critical for the operations’ profitability. Consequently, interventions targeting such components can reduce the opportunities and incentives to engage in online crime through an increase in criminal operational costs, and in the risk of apprehension.
-
measuring and analyzing search redirection attacks in the illicit online prescription Drug Trade
USENIX Security Symposium, 2011Co-Authors: Nektarios Leontiadis, Tyler Moore, Nicolas ChristinAbstract:We investigate the manipulation of web search results to promote the unauthorized sale of prescription Drugs. We focus on search-redirection attacks, where miscreants compromise high-ranking websites and dynamically redirect traffic to different pharmacies based upon the particular search terms issued by the consumer. We constructed a representative list of 218 Drug-related queries and automatically gathered the search results on a daily basis over nine months in 2010-2011. We find that about one third of all search results are one of over 7 000 infected hosts triggered to redirect to a few hundred pharmacy websites. Legitimate pharmacies and health resources have been largely crowded out by search-redirection attacks and blog spam. Infections persist longest on websites with high PageRank and from .edu domains. 96% of infected domains are connected through traffic redirection chains, and network analysis reveals that a few concentrated communities link many otherwise disparate pharmacies together. We calculate that the conversion rate of web searches into sales lies between 0.3% and 3%, and that more illegal Drugs sales are facilitated by search-redirection attacks than by email spam. Finally, we observe that concentration in both the source infections and redirectors presents an opportunity for defenders to disrupt online pharmacy sales.
Natalia Corazza Padovani - One of the best experts on this subject based on the ideXlab platform.
-
plotting prisons flows and affections brazilian female prisoners between the transnational Drug Trade and sex markets in barcelona
Criminology & Criminal Justice, 2016Co-Authors: Natalia Corazza PadovaniAbstract:This article draws on data from a larger study: a multi-site ethnography of the networks established by people confined in female prisons in the cities of Sao Paulo and Barcelona. Focusing on ethnographic data from my fieldwork in Barcelona, I analyze the displacements created by transnational Drug Trade networks which involve sex work and marriage in Spain. Brazilian prisoners in Barcelona (accused of "crimes against public health" - involvement in the sale and transportation of cocaine) create aid networks involving the "owners" of apartment-based prostitution and Trade relations with men who are also prisoners in Catalonian penitentiaries. These entanglements forged between transnational Drug Trade, sex Trade and aid networks, as seen from the carceral and migration trajectories of the Brazilians imprisoned in Catalonia, allow us to analyze how through plots produced between (il)legal markets and networks, Brazilian women imprisoned in Catalonia reframe their foreign national prison experience. I argue that in transnational contexts social markers such as class, race, gender, sexuality and nationality are managed by the subjects in their relationships. Hence, the analysis exposed in this article emphasizes the possibilities of agency managed by Brazilian women arrested in Barcelona facing the Catalan prison system as well as the way these women rearrange their conditions as "imprisoned foreigners" and their prospects of freedom. Language: en
-
plotting prisons flows and affections brazilian female prisoners between the transnational Drug Trade and sex markets in barcelona
Social Science Research Network, 2016Co-Authors: Natalia Corazza PadovaniAbstract:This article draws on data from a larger study: a multi-site ethnography of the networks established by people confined in female prisons in the cities of Sao Paulo and Barcelona. Focusing on ethnographic data from my fieldwork in Barcelona, I analyze the displacements created by transnational Drug Trade networks which involve sex work and marriage in Spain. Brazilian prisoners in Barcelona (accused of ‘crimes against public health’ ― involvement in the sale and transportation of cocaine) create aid networks involving the ‘owners’ of apartment-based prostitution and Trade relations with men who are also prisoners in Catalonian penitentiaries. These entanglements forged between transnational Drug Trade, sex Trade and aid networks, as seen from the carceral and migration trajectories of the Brazilians imprisoned in Catalonia, allow us to analyze how through plots produced between (il)legal markets and networks, Brazilian women imprisoned in Catalonia reframe their foreign national prison experience. I argue that in transnational contexts social markers such as class, race, gender, sexuality and nationality are managed by the subjects in their relationships. Hence, the analysis exposed in this article emphasizes the possibilities of agency managed by Brazilian women arrested in Barcelona facing the Catalan prison system as well as the way these women rearrange their conditions as ‘imprisoned foreigners’ and their prospects of freedom.
Bryan A Liang - One of the best experts on this subject based on the ideXlab platform.
-
the global counterfeit Drug Trade patient safety and public health risks
Journal of Pharmaceutical Sciences, 2011Co-Authors: Tim K Mackey, Bryan A LiangAbstract:Counterfeit Drugs are a global problem with significant and well-documented consequences for global health and patient safety, including Drug resistance and patient deaths. This multibillion-dollar industry does not respect geopolitical borders, and threatens public health in both rich and resource-poor nations alike. The epidemiology of counterfeits is also wide in breadth and scope, including thousands of counterfeit incidents per year, encompassing all types of therapeutic classes, and employing a complex global supply chain network enabling this illegal activity. In addition, information technologies available through the Internet and sales via online pharmacies have allowed the criminal element to thrive in an unregulated environment of anonymity, deception, and lack of adequate enforcement. Though recent global enforcement efforts have led to arrests of online counterfeit sellers, such actions have not stemmed supplies from illegal online sellers or kept up with their creativity in illegally selling their products. To address this issue, we propose a global policy framework utilizing public-private partnership models with centralized surveillance reporting that would enable cooperation and coordination to combat this global health crisis.
-
global health commentary the global counterfeit Drug Trade patient safety and public health risks
2011Co-Authors: Tim K Mackey, Bryan A LiangAbstract:Counterfeit Drugs are a global problem with significant and well-documented consequences for global health and patient safety, including Drug resistance and patient deaths. This multibillion-dollar industry does not respect geopolitical borders, and threatens public health in both rich and resource-poor nations alike. The epidemiology of counterfeits is also wide in breadth and scope, including thousands of counterfeit incidents per year, encompassing all types of therapeutic classes, and employing a complex global supply chain network enabling this illegalactivity.Inaddition,informationtechnologiesavailablethroughtheInternetandsalesvia online pharmacies have allowed the criminal element to thrive in an unregulated environment of anonymity, deception, and lack of adequate enforcement. Though recent global enforcement efforts have led to arrests of online counterfeit sellers, such actions have not stemmed supplies from illegal online sellers or kept up with their creativity in illegally selling their products. To address this issue, we propose a global policy framework utilizing public-private partnership models with centralized surveillance reporting that would enable cooperation and coordination to combat this global health crisis. © 2011 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 100:4571-4579, 2011
Uma R Shaanker - One of the best experts on this subject based on the ideXlab platform.
-
dna barcoding to assess species adulteration in raw Drug Trade of bala genus sida l herbal products in south india
Biochemical Systematics and Ecology, 2015Co-Authors: J Santhosh U Kumar, K. N. Ganeshaiah, V Krishna, Gopalakrishnan Saroja Seethapathy, U Senthilkumar, Subramanyam Ragupathy, R Ganesan, Steven G Newmaster, G Ravikanth, Uma R ShaankerAbstract:The genus Sida L. (family: Malvaceae) is widely used in India and many other countries including China, South East Asia, Africa and South America for treating various neurological disorders and for improving general health and vigour. However, as with many other herbal medicines, it is believed that the Sida products sold in the market may be adulterated with other related or unrelated plant species. In this study, we investigate species adulteration in the raw herbal Trade of Sida natural health products (NHPs) in southern India. DNA barcoding was used as a tool to identify the ingredients in the NHPs. A biological reference material (BRM) library for Sida and closely related species was developed using taxonomically authenticated species. DNA barcodes for the species were developed using one nuclear (ITS) and two chloroplast regions (matK and psbA-trnH). The psbA-trnH and ITS region were found to effectively discriminate all species with an interspecific distance of 0.133 and 0.149 and intra-species distance of 0.007 and 0.015 respectively. These DNA barcodes were used to identify the ingredients in raw Sida herbal products obtained from 10 markets in Southern India. Our study indicated that species adulteration in the market samples is rampant especially in case of Sida cordifolia, where all the market samples analyzed were Sida acuta. We discuss the results and the need for a robust herbal Drug authentication system to regulate the quality in raw herbal Trade market.
-
assessing species admixtures in raw Drug Trade of phyllanthus a hepato protective plant using molecular tools
Journal of Ethnopharmacology, 2010Co-Authors: R Srirama, N Sreejayan, B R Gurumurthy, M B Shivanna, M Sanjappa, K. N. Ganeshaiah, Umapathy Senthilkumar, Gudasalamani Ravikanth, Uma R ShaankerAbstract:Abstract Ethnopharmacological relevance Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. Aim of the study To assess species admixtures in raw Drug Trade of Phyllanthus using morphological and DNA barcoding tools. Materials and methods Samples of Phyllanthus used in raw Drug Trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF – GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR – CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. Results Morphological analysis of market samples revealed six different species of Phyllanthus in the Trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. Conclusion Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw Drug Trade of Phyllanthus.
