The Experts below are selected from a list of 58491 Experts worldwide ranked by ideXlab platform
Mohamed Jijakli - One of the best experts on this subject based on the ideXlab platform.
-
development of a rapid rt pcr test for the detection of peach latent mosaic viroid pear blister canker viroid hop stunt viroid and apple scar skin viroid in Fruit Trees from tunisia
Journal of Phytopathology, 2006Co-Authors: Fekih I Hassen, Mohamed Marrakchi, Jean Kummert, Hamadi Fakhfakh, S. Roussel, Mohamed JijakliAbstract:A reverse transcription polymerase chain reaction was developed to investigate the occurrence ofpeach latent mosaic viroid� (PLMVd), � pear blister canker viroid� (PBCVd), � hop stunt viroid� (HSVd) andapple scar skin viroid� (ASSVd) on Fruit Trees (peach, pear, almond and apple) in Tunisia. The test was initially performed with total RNA preparations from selected isolates and then applied to total RNA preparations from leaf or bark tissues of Fruit Trees collected in the north of Tunisia and the Sahel. PLMVd was found to occur in peach and pear Trees, HSVd in pear, peach and almond Trees, and PBCVd in pear Trees. Mixed PBCVd-HSVd and PLMVd-HSVd infections occurred naturally in pear Trees. ASSVd was not detected in any samples from apple Trees. The identity of the detected viroids was confirmed by comparing their sequences with those of other previously characterized isolates. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues and from total RNA preparations were identical. This improved test is thus quick and useful for large-scale routine analy- sis. It can be used in a certification programme to con- tribute to prevention of the occurrence and spread of PLMVd, HSVd, PBCVd and ASSVd in Tunisia.
-
first report of pear blister canker viroid peach latent mosaic viroid and hop stunt viroid infecting Fruit Trees in tunisia
Plant Disease, 2004Co-Authors: Fekih I Hassen, Mohamed Marrakchi, Jean Kummert, Hamadi Fakhfakh, S Marbot, Mohamed JijakliAbstract:Viroids of Fruit Trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of Fruit Trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field Trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field Trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5' GTCTGAAGCCTGGGCGCTGG 3' and reverse primer 5' CCTTCGT CGACGACGAGCCGAG 3' were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach Trees tested, 12 were found infected with PLMVd. Two pear Trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear Trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in Fruit Trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum Fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting Fruit Trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of Fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Legumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.
Patrick Ollitraul - One of the best experts on this subject based on the ideXlab platform.
-
a nuclear phylogenetic analysis snps indels and ssrs deliver new insights into the relationships in the true citrus Fruit Trees group citrinae rutaceae and the origin of cultivated species
Annals of Botany, 2013Co-Authors: Andres Garcialo, Franck Curk, Hage Snoussitrifa, Raphael Morillo, Gema Ancillo, Francois Luro, Luis Navarro, Patrick OllitraulAbstract:† Background and Aims Despite differences in morphology, the genera representing ‘true citrus Fruit Trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus Fruit Trees’ were clarified. † Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. † Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for intertaxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. † Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis.
Fekih I Hassen - One of the best experts on this subject based on the ideXlab platform.
-
development of a rapid rt pcr test for the detection of peach latent mosaic viroid pear blister canker viroid hop stunt viroid and apple scar skin viroid in Fruit Trees from tunisia
Journal of Phytopathology, 2006Co-Authors: Fekih I Hassen, Mohamed Marrakchi, Jean Kummert, Hamadi Fakhfakh, S. Roussel, Mohamed JijakliAbstract:A reverse transcription polymerase chain reaction was developed to investigate the occurrence ofpeach latent mosaic viroid� (PLMVd), � pear blister canker viroid� (PBCVd), � hop stunt viroid� (HSVd) andapple scar skin viroid� (ASSVd) on Fruit Trees (peach, pear, almond and apple) in Tunisia. The test was initially performed with total RNA preparations from selected isolates and then applied to total RNA preparations from leaf or bark tissues of Fruit Trees collected in the north of Tunisia and the Sahel. PLMVd was found to occur in peach and pear Trees, HSVd in pear, peach and almond Trees, and PBCVd in pear Trees. Mixed PBCVd-HSVd and PLMVd-HSVd infections occurred naturally in pear Trees. ASSVd was not detected in any samples from apple Trees. The identity of the detected viroids was confirmed by comparing their sequences with those of other previously characterized isolates. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues and from total RNA preparations were identical. This improved test is thus quick and useful for large-scale routine analy- sis. It can be used in a certification programme to con- tribute to prevention of the occurrence and spread of PLMVd, HSVd, PBCVd and ASSVd in Tunisia.
-
first report of pear blister canker viroid peach latent mosaic viroid and hop stunt viroid infecting Fruit Trees in tunisia
Plant Disease, 2004Co-Authors: Fekih I Hassen, Mohamed Marrakchi, Jean Kummert, Hamadi Fakhfakh, S Marbot, Mohamed JijakliAbstract:Viroids of Fruit Trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of Fruit Trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field Trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field Trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5' GTCTGAAGCCTGGGCGCTGG 3' and reverse primer 5' CCTTCGT CGACGACGAGCCGAG 3' were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach Trees tested, 12 were found infected with PLMVd. Two pear Trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear Trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in Fruit Trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum Fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting Fruit Trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of Fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Legumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.
Mohamed Marrakchi - One of the best experts on this subject based on the ideXlab platform.
-
development of a rapid rt pcr test for the detection of peach latent mosaic viroid pear blister canker viroid hop stunt viroid and apple scar skin viroid in Fruit Trees from tunisia
Journal of Phytopathology, 2006Co-Authors: Fekih I Hassen, Mohamed Marrakchi, Jean Kummert, Hamadi Fakhfakh, S. Roussel, Mohamed JijakliAbstract:A reverse transcription polymerase chain reaction was developed to investigate the occurrence ofpeach latent mosaic viroid� (PLMVd), � pear blister canker viroid� (PBCVd), � hop stunt viroid� (HSVd) andapple scar skin viroid� (ASSVd) on Fruit Trees (peach, pear, almond and apple) in Tunisia. The test was initially performed with total RNA preparations from selected isolates and then applied to total RNA preparations from leaf or bark tissues of Fruit Trees collected in the north of Tunisia and the Sahel. PLMVd was found to occur in peach and pear Trees, HSVd in pear, peach and almond Trees, and PBCVd in pear Trees. Mixed PBCVd-HSVd and PLMVd-HSVd infections occurred naturally in pear Trees. ASSVd was not detected in any samples from apple Trees. The identity of the detected viroids was confirmed by comparing their sequences with those of other previously characterized isolates. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues and from total RNA preparations were identical. This improved test is thus quick and useful for large-scale routine analy- sis. It can be used in a certification programme to con- tribute to prevention of the occurrence and spread of PLMVd, HSVd, PBCVd and ASSVd in Tunisia.
-
first report of pear blister canker viroid peach latent mosaic viroid and hop stunt viroid infecting Fruit Trees in tunisia
Plant Disease, 2004Co-Authors: Fekih I Hassen, Mohamed Marrakchi, Jean Kummert, Hamadi Fakhfakh, S Marbot, Mohamed JijakliAbstract:Viroids of Fruit Trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of Fruit Trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field Trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field Trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5' GTCTGAAGCCTGGGCGCTGG 3' and reverse primer 5' CCTTCGT CGACGACGAGCCGAG 3' were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach Trees tested, 12 were found infected with PLMVd. Two pear Trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear Trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in Fruit Trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum Fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting Fruit Trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of Fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Legumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.
Hamadi Fakhfakh - One of the best experts on this subject based on the ideXlab platform.
-
development of a rapid rt pcr test for the detection of peach latent mosaic viroid pear blister canker viroid hop stunt viroid and apple scar skin viroid in Fruit Trees from tunisia
Journal of Phytopathology, 2006Co-Authors: Fekih I Hassen, Mohamed Marrakchi, Jean Kummert, Hamadi Fakhfakh, S. Roussel, Mohamed JijakliAbstract:A reverse transcription polymerase chain reaction was developed to investigate the occurrence ofpeach latent mosaic viroid� (PLMVd), � pear blister canker viroid� (PBCVd), � hop stunt viroid� (HSVd) andapple scar skin viroid� (ASSVd) on Fruit Trees (peach, pear, almond and apple) in Tunisia. The test was initially performed with total RNA preparations from selected isolates and then applied to total RNA preparations from leaf or bark tissues of Fruit Trees collected in the north of Tunisia and the Sahel. PLMVd was found to occur in peach and pear Trees, HSVd in pear, peach and almond Trees, and PBCVd in pear Trees. Mixed PBCVd-HSVd and PLMVd-HSVd infections occurred naturally in pear Trees. ASSVd was not detected in any samples from apple Trees. The identity of the detected viroids was confirmed by comparing their sequences with those of other previously characterized isolates. The test was then simplified by direct use of diluted crude plant extracts. The results obtained from crude sap extracts of leaves or bark tissues and from total RNA preparations were identical. This improved test is thus quick and useful for large-scale routine analy- sis. It can be used in a certification programme to con- tribute to prevention of the occurrence and spread of PLMVd, HSVd, PBCVd and ASSVd in Tunisia.
-
first report of pear blister canker viroid peach latent mosaic viroid and hop stunt viroid infecting Fruit Trees in tunisia
Plant Disease, 2004Co-Authors: Fekih I Hassen, Mohamed Marrakchi, Jean Kummert, Hamadi Fakhfakh, S Marbot, Mohamed JijakliAbstract:Viroids of Fruit Trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of Fruit Trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field Trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field Trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5' GTCTGAAGCCTGGGCGCTGG 3' and reverse primer 5' CCTTCGT CGACGACGAGCCGAG 3' were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach Trees tested, 12 were found infected with PLMVd. Two pear Trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear Trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in Fruit Trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum Fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting Fruit Trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of Fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Legumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.
