The Experts below are selected from a list of 8568 Experts worldwide ranked by ideXlab platform
Ricardo Flores - One of the best experts on this subject based on the ideXlab platform.
-
symptomatic plant viroid infections in phytopathogenic fungi a request for a critical reassessment
Proceedings of the National Academy of Sciences of the United States of America, 2020Co-Authors: P Serra, Alberto Carbonell, Selma Gagozachert, Beatriz Navarro, Shifang Li, Francesco Di Serio, Ricardo FloresAbstract:Since their discovery (1), Viroids—small (∼250 to 430 nt), non–protein-coding, circular RNAs—are thought to infect and cause disease only in plants (2); thus, the report that they infect and incite symptoms in filamentous phytopathogenic fungi (3) is surprising. Viroids are classified into two families (4). Members of the Pospiviroidae , including potato spindle tuber viroid (PSTVd) (1, 5), replicate in the nucleus through an RNA–RNA rolling-circle mechanism catalyzed by host enzymes (RNA polymerase, RNase, and RNA ligase). Members of the Avsunviroidae , like peach latent mosaic viroid (PLMVd) (6), form hammerhead ribozymes (HHRz) that functionally substitute the RNase during replication in chloroplasts (4). The host range of the second family is restricted to plant species (or relatives) in which the Viroids were described. Unexpectedly, Wei et al. (3) report that seven Viroids, including PLMVd and avocado sunblotch viroid (ASBVd) (both of the Avsunviroidae ), infect Nicotiana benthamiana , a known host for only some members of … [↵][1]1To whom correspondence may be addressed. Email: rflores{at}ibmcp.upv.es or francesco.diserio{at}ipsp.cnr.it. [1]: #xref-corresp-1-1
-
different rates of spontaneous mutation of chloroplastic and nuclear Viroids as determined by high fidelity ultra deep sequencing
PLOS Pathogens, 2017Co-Authors: Amparo Lopezcarrasco, Selma Gagozachert, Sonia Delgado, Ricardo Flores, Cristina Ballesteros, Vicente Sentandreu, Rafael SanjuanAbstract:Mutation rates vary by orders of magnitude across biological systems, being higher for simpler genomes. The simplest known genomes correspond to Viroids, subviral plant replicons constituted by circular non-coding RNAs of few hundred bases. Previous work has revealed an extremely high mutation rate for chrysanthemum chlorotic mottle viroid, a chloroplast-replicating viroid. However, whether this is a general feature of Viroids remains unclear. Here, we have used high-fidelity ultra-deep sequencing to determine the mutation rate in a common host (eggplant) of two Viroids, each representative of one family: the chloroplastic eggplant latent viroid (ELVd, Avsunviroidae) and the nuclear potato spindle tuber viroid (PSTVd, Pospiviroidae). This revealed higher mutation frequencies in ELVd than in PSTVd, as well as marked differences in the types of mutations produced. Rates of spontaneous mutation, quantified in vivo using the lethal mutation method, ranged from 1/1000 to 1/800 for ELVd and from 1/7000 to 1/3800 for PSTVd depending on sequencing run. These results suggest that extremely high mutability is a common feature of chloroplastic Viroids, whereas the mutation rates of PSTVd and potentially other nuclear Viroids appear significantly lower and closer to those of some RNA viruses.
-
Origin and Evolution of Viroids
Viroids and Satellites, 2017Co-Authors: Francesco Di Serio, Beatriz Navarro, Ricardo FloresAbstract:With their small, circular, nonprotein-coding RNA genome, which may be endowed with catalytic activity, Viroids have been proposed to be “fossils” of an RNA world preceding the cellular world based on DNA and proteins. This chapter summarizes the arguments sustaining this proposal and discusses the possible evolutionary scenarios for the adaptation of ancestor Viroids to a cellular environment. The implications of the quasispecies nature of viroid populations and the constraints governing their evolution are also addressed, highlighting how a deeper understanding of viroid evolution is closely linked to advances in the molecular mechanisms mediating plant–viroid interactions.
-
current status of viroid taxonomy
Archives of Virology, 2014Co-Authors: Francesco Di Serio, Th J J Verhoeven, Teruo Sano, Georgios Vidalakis, John W. Randles, Vicente Pallas, Shifang Li, Ricardo Flores, Robert A OwensAbstract:Viroids are the smallest autonomous infectious nucleic acids known so far. With a small circular RNA genome of about 250-400 nt, which apparently does not code for any protein, Viroids replicate and move systemically in host plants. Since the discovery of the first viroid almost forty-five years ago, many different Viroids have been isolated, characterized and, frequently, identified as the causal agents of plant diseases. The first viroid classification scheme was proposed in the early 1990s and adopted by the International Committee on Taxonomy of Viruses (ICTV) a few years later. Here, the current viroid taxonomy scheme and the criteria for viroid species demarcation are discussed, highlighting the main taxonomic questions currently under consideration by the ICTV Viroid Study Group. The impact of correct taxonomic annotation of viroid sequence variants is also addressed, taking into consideration the increasing application of next-generation sequencing and bioinformatics for known and previously unrecognized Viroids.
-
rolling circle replication of Viroids viroid like satellite rnas and hepatitis delta virus variations on a theme
RNA Biology, 2011Co-Authors: Ricardo Flores, Douglas Grubb, Mariaangeles Nohales, Sonia Delgado, Amine Elleuch, Selma GagoAbstract:Viroids and viroid-like satellite RNAs from plants, and the human hepatitis delta virus (HDV) RNA share some properties that include small size, circularity and replication through a rolling-circle mechanism. Replication occurs in different cell compartments (nucleus, chloroplast and membrane-associated cytoplasmatic vesicles) and has three steps: RNA polymerization, cleavage and ligation. The first step generates oligomeric RNAs that result from the reiterative transcription of the circular templates of one or both polarities, and is catalyzed by either the RNA-dependent RNA polymerase of the helper virus on which viroid-like satellite RNAs are functionally dependent, or by host DNA-dependent RNA polymerases that, remarkably, Viroids and HDV redirect to transcribe RNA templates. Cleavage is mediated by host enzymes in certain Viroids and viroid-like satellite RNAs, while in others and in HDV is mediated by cis-acting ribozymes of three classes. Ligation appears to be catalyzed mainly by host enzymes. Rep...
Francesco Di Serio - One of the best experts on this subject based on the ideXlab platform.
-
symptomatic plant viroid infections in phytopathogenic fungi a request for a critical reassessment
Proceedings of the National Academy of Sciences of the United States of America, 2020Co-Authors: P Serra, Alberto Carbonell, Selma Gagozachert, Beatriz Navarro, Shifang Li, Francesco Di Serio, Ricardo FloresAbstract:Since their discovery (1), Viroids—small (∼250 to 430 nt), non–protein-coding, circular RNAs—are thought to infect and cause disease only in plants (2); thus, the report that they infect and incite symptoms in filamentous phytopathogenic fungi (3) is surprising. Viroids are classified into two families (4). Members of the Pospiviroidae , including potato spindle tuber viroid (PSTVd) (1, 5), replicate in the nucleus through an RNA–RNA rolling-circle mechanism catalyzed by host enzymes (RNA polymerase, RNase, and RNA ligase). Members of the Avsunviroidae , like peach latent mosaic viroid (PLMVd) (6), form hammerhead ribozymes (HHRz) that functionally substitute the RNase during replication in chloroplasts (4). The host range of the second family is restricted to plant species (or relatives) in which the Viroids were described. Unexpectedly, Wei et al. (3) report that seven Viroids, including PLMVd and avocado sunblotch viroid (ASBVd) (both of the Avsunviroidae ), infect Nicotiana benthamiana , a known host for only some members of … [↵][1]1To whom correspondence may be addressed. Email: rflores{at}ibmcp.upv.es or francesco.diserio{at}ipsp.cnr.it. [1]: #xref-corresp-1-1
-
Reassessment of Viroid RNA Cytosine Methylation Status at the Single Nucleotide Level
MDPI AG, 2019Co-Authors: Francesco Di Serio, José-antonio Daròs, Enza Maria Torchetti, Beatriz NavarroAbstract:Composed of a few hundreds of nucleotides, Viroids are infectious, circular, non-protein coding RNAs able to usurp plant cellular enzymes and molecular machineries to replicate and move in their hosts. Several secondary and tertiary RNA structural motifs have been implicated in the viroid infectious cycle, but whether modified nucleotides, such as 5C-methylcytosine (m5C), also play a role has not been deeply investigated so far. Here, the possible existence of m5C in both RNA polarity strands of potato spindle tuber viroid and avocado sunblotch viroid -which are representative members of the nucleus- and chloroplast-replicating Viroids, respectively- has been assessed at single nucleotide level. We show that a standard bisulfite protocol efficiently used for identifying m5C in cellular RNAs may generate false positive results in the case of the highly structured viroid RNAs. Applying a bisulfite conversion protocol specifically adapted to RNAs with high secondary structure, no m5C was identified in both polarity strands of both Viroids, indicating that this specific nucleotide modification does not likely play a role in viroid biology
-
Reassessment of Viroid RNA Cytosine Methylation Status at the Single Nucleotide Level
Multidisciplinary Digital Publishing Institute, 2019Co-Authors: Francesco Di Serio, Torchetti, Enza Maria, Daròs Arnau, José Antonio, Navarro BeatrizAbstract:Composed of a few hundreds of nucleotides, Viroids are infectious, circular, non-protein coding RNAs able to usurp plant cellular enzymes and molecular machineries to replicate and move in their hosts. Several secondary and tertiary RNA structural motifs have been implicated in the viroid infectious cycle, but whether modified nucleotides, such as 5C-methylcytosine (m5C), also play a role has not been deeply investigated so far. Here, the possible existence of m5C in both RNA polarity strands of potato spindle tuber viroid and avocado sunblotch viroid -which are representative members of the nucleus- and chloroplast-replicating Viroids, respectively- has been assessed at single nucleotide level. We show that a standard bisulfite protocol efficiently used for identifying m5C in cellular RNAs may generate false positive results in the case of the highly structured viroid RNAs. Applying a bisulfite conversion protocol specifically adapted to RNAs with high secondary structure, no m5C was identified in both polarity strands of both Viroids, indicating that this specific nucleotide modification does not likely play a role in viroid biology.This project was partially funded by CNR Short-Term Mobility Programs (2013 and 2014 to FDS) and by the Spanish Ministerio de Ciencia, Innovación y Universidades grant BIO2017-83184-R (co-financed FEDER funds)We acknowledge support by the CSIC Open Access Publication Initiative through its Unit of Information Resources for Research (URICI)Peer reviewe
-
Viroids Infecting the Grapevine
Grapevine Viruses: Molecular Biology Diagnostics and Management, 2017Co-Authors: Francesco Di Serio, Majid Hajizadeh, Keramat Izadpanah, Beatriz NavarroAbstract:Viroids are nonprotein-coding, small, circular RNAs infecting plants in which they may induce specific symptoms. Five different Viroids have been identified in the grapevine in the period elapsed from 1985 to 1990. Since then, no new viroid has been reported from grapevines until the application of next-generation sequencing allowed the discovery of an additional viroid and a new viroid-like RNA. Possibly, new small, circular RNAs will be identified in the future by metagenomic approaches, but bioassays, which are time intensive and require phytopathological expertise, will always be needed for establishing conclusively their true identity as Viroids. Although Viroids generally do not elicit severe symptoms in grapevines, some of them are the agent of diseases in certain environmental conditions or in combination with certain viruses. Some of grapevine-infecting Viroids may cause severe diseases in other crops. This chapter reviews the molecular, biological, and epidemiological features of Viroids and viroid-like RNAs infecting grapevines and the methods for their detection and control and discusses the future perspectives of research.
-
Origin and Evolution of Viroids
Viroids and Satellites, 2017Co-Authors: Francesco Di Serio, Beatriz Navarro, Ricardo FloresAbstract:With their small, circular, nonprotein-coding RNA genome, which may be endowed with catalytic activity, Viroids have been proposed to be “fossils” of an RNA world preceding the cellular world based on DNA and proteins. This chapter summarizes the arguments sustaining this proposal and discusses the possible evolutionary scenarios for the adaptation of ancestor Viroids to a cellular environment. The implications of the quasispecies nature of viroid populations and the constraints governing their evolution are also addressed, highlighting how a deeper understanding of viroid evolution is closely linked to advances in the molecular mechanisms mediating plant–viroid interactions.
Robert A Owens - One of the best experts on this subject based on the ideXlab platform.
-
current status of viroid taxonomy
Archives of Virology, 2014Co-Authors: Francesco Di Serio, Th J J Verhoeven, Teruo Sano, Georgios Vidalakis, John W. Randles, Vicente Pallas, Shifang Li, Ricardo Flores, Robert A OwensAbstract:Viroids are the smallest autonomous infectious nucleic acids known so far. With a small circular RNA genome of about 250-400 nt, which apparently does not code for any protein, Viroids replicate and move systemically in host plants. Since the discovery of the first viroid almost forty-five years ago, many different Viroids have been isolated, characterized and, frequently, identified as the causal agents of plant diseases. The first viroid classification scheme was proposed in the early 1990s and adopted by the International Committee on Taxonomy of Viruses (ICTV) a few years later. Here, the current viroid taxonomy scheme and the criteria for viroid species demarcation are discussed, highlighting the main taxonomic questions currently under consideration by the ICTV Viroid Study Group. The impact of correct taxonomic annotation of viroid sequence variants is also addressed, taking into consideration the increasing application of next-generation sequencing and bioinformatics for known and previously unrecognized Viroids.
-
Mexican papita viroid and tomato planta macho viroid belong to a single species in the genus Pospiviroid
Archives of Virology, 2011Co-Authors: J.th.j. Verhoeven, J W Roenhorst, Robert A OwensAbstract:Tomato planta macho viroid (TPMVd) and Mexican papita viroid (MPVd) are two closely related (>90% sequence identity) members of the genus Pospiviroid. Their current status as members of separate species is based upon the reported ability of TPMVd to replicate in Gomphrena globosa and the inability of this viroid to evoke flower break in N. glutinosa. Characterization of a viroid recently isolated from diseased tomato plants grown in Mexico (identical to GenBank accession GQ131573) casts doubt on this earlier report and indicates that these Viroids should be classified as members of a single species. Giving priority to the older name, we propose including both of these Viroids in the current species Tomato planta macho viroid.
-
natural infections of tomato by citrus exocortis viroid columnea latent viroid potato spindle tuber viroid and tomato chlorotic dwarf viroid
European Journal of Plant Pathology, 2004Co-Authors: Th J J Verhoeven, C C C Jansen, T M Willemen, Robert A Owens, J W RoenhorstAbstract:Since 1988, Viroids have been occasionally detected in samples of tomato (Lycopersicon esculentum) originating both in the Netherlands and other countries. Infected plants showed chlorosis, bronzing, leaf distortion and growth reduction. Initial diagnosis of these Viroids was by return-polyacrylamide gel electrophoresis, which did not allow a further identification. This paper reports the identification of these Viroids by reverse transcription-polymerase chain reaction and sequence analysis. Three known Viroids of tomato, i.e. Citrus exocortis viroid, Potato spindle tuber viroid and Tomato chlorotic dwarf viroid were identified. In addition, six isolates were identified as Columnea latent viroid, a viroid so far only detected in some ornamental species. Like the isolates previously isolated from ornamental species, the isolates from tomato share genetic characteristics of both the genera Hostuviroid and Pospiviroid. The biological characteristics of all four Viroids, especially their potential effects on both potato (Solanum tuberosum) and tomato, stress the need for reconsideration of their phytosanitary risks.
Teruo Sano - One of the best experts on this subject based on the ideXlab platform.
-
Economic Significance of Fruit Tree and Grapevine Viroids
Viroids and Satellites, 2017Co-Authors: Ahmed Hadidi, Georgios Vidalakis, Teruo SanoAbstract:Abstract Fruit tree and grapevine Viroids infect a large number of plant species and the economic significance of these Viroids may vary according to the viroid or variant as well as to the host plant. Those of greatest economic importance are the Viroids associated with apple scar skin, peach latent mosaic, avocado sunblotch, citrus exocortis, and citrus cachexia diseases. Certain citrus Viroids have been utilized in producing dwarfed citrus trees in high density planting, which results in several beneficial economic effects. Most grapevine Viroids are latent, however, the grapevine yellow speckle Viroids have been implicated in vein banding disease.
-
current status of viroid taxonomy
Archives of Virology, 2014Co-Authors: Francesco Di Serio, Th J J Verhoeven, Teruo Sano, Georgios Vidalakis, John W. Randles, Vicente Pallas, Shifang Li, Ricardo Flores, Robert A OwensAbstract:Viroids are the smallest autonomous infectious nucleic acids known so far. With a small circular RNA genome of about 250-400 nt, which apparently does not code for any protein, Viroids replicate and move systemically in host plants. Since the discovery of the first viroid almost forty-five years ago, many different Viroids have been isolated, characterized and, frequently, identified as the causal agents of plant diseases. The first viroid classification scheme was proposed in the early 1990s and adopted by the International Committee on Taxonomy of Viruses (ICTV) a few years later. Here, the current viroid taxonomy scheme and the criteria for viroid species demarcation are discussed, highlighting the main taxonomic questions currently under consideration by the ICTV Viroid Study Group. The impact of correct taxonomic annotation of viroid sequence variants is also addressed, taking into consideration the increasing application of next-generation sequencing and bioinformatics for known and previously unrecognized Viroids.
-
comprehensive diversity analysis of Viroids infecting grapevine in china and japan
Virus Research, 2012Co-Authors: Dongmei Jiang, Teruo Sano, Masaharu Tsuji, Hiroyuki Araki, Kyota Sagawa, Charith Raj Adkar Purushothama, Zhixiang Zhang, Rui Guo, Lianhui Xie, Hongqing WangAbstract:To date, several viroid species have been shown to infect grapevine, including Hop stunt viroid (HpSVd), Citrus exocortis viroid (CEVd), Australian grapevine viroid (AGVd), Grapevine yellow speckle viroid-1 (GYSVd-1), Grapevine yellow speckle viroid-2 (GYSVd-2) and a tentative new species, Grapevine yellow speckle viroid-3 (GYSVd-3). Here, we identified and analyzed the distribution, genetic diversity, and molecular properties of Viroids infecting grapevine cultivated in China and Japan, including old grapevines. The analysis showed that all the five known Viroids and a tentative species GYSVd-3 infecting grapevine exist in China, and three of them (HpSVd, GYSVd-1 and GYSVd-3) exist in Japan. The contrast in diversity of viroid species in old grapevines from China and Japan may reflect different history of viticulture between the two countries. In general, the species of Viroids infecting grapevine in China, as well as those in Iran and Australia, were more diverse than in the other countries. The population structure of Viroids infecting grapevine in China and Japan showed species-dependency; i.e., HpSVd shared similar population structures in both countries, but GYSVd-1, GYSVd-2, and AGVd showed regional disparity even within the same country, although the role of sequence diversity in the biology of Viroids infecting grapevine, such as the pathogenicity and evolution, still needs further study.
-
Construction of a multiprobe for the simultaneous detection of Viroids infecting citrus trees
Virus Genes, 2006Co-Authors: Oded Cohen, Teruo Sano, Ozgur Batuman, Gulshan Stanbekova, Munir Mawassi, Moshe Bar-josephAbstract:Infections with different viroid species are common among cultivated fruit trees and grapevines, and many old-clone citrus varieties contain up to five citrus Viroids (CVds) within a single tree. This paper describes the construction of a CVd-Multiprobe consisting of full-length clones of Hop stunt viroid, Citrus exocortis viroid, Citrus bent leaf viroid and CVd-III. The CVd-Multiprobe was tested against RNA transcripts of the four Viroids and RNA extracts from plants singly infected with CEVd or HSVd or multiply infected with different CVds. The Viroids were effectively diagnosed with the DIG labeled CVd-Multiprobe when tested by Northern hybridization or dot blot analyses. The CVd-Multiprobe does not provide information on the specific viroid resulting in a positive signal. However, this should not be considered as a problem, since most citrus certification programs will discard budwood source trees infected with any of the known CVds.
-
first report of hop stunt viroid from prunus persica with dapple fruit symptoms in china
Plant Pathology, 2006Co-Authors: Yijun Zhou, Teruo Sano, Z Cheng, S F LiAbstract:Five distinct Viroids have been recognized in grapevine ( Vitis vinifera ) by sequence analysis (Hadidi et al ., 2003). Grapes are one of the most important fruit crops in China and a survey was conducted during 2002–05 to identify Viroids affecting the crop. Leaves were harvested in June from 70 samples, comprising seven wild plants from Liaoning, 58 varieties in a grapevine nursery in Beijing, two from Xinjiang autonomous region and three from Hebei. Nucleic acids were extracted (Li et al ., 1995) and tested for the presence of four grapevine Viroids by dot-blot or northern hybridization using digoxygenin-labelled riboprobes for Hop stunt viroid (HSVd), Apple fruit crinkle viroid (AFCVd), Grapevine yellow speckle viroid (GYSVd) and Citrus exocortis viroid (CEVd) (Li et al ., 1995; Sano et al ., 2000; Sano et al ., 2004). HSVd was detected in 41 samples, GYSVd in 29 and AFCVd in one. CEVd was not detected. As AFCVd has never been reported from grape and the probe shared ∼ 85% sequence similarity with Australian grapevine viroid (AGVd), the latter sample seems more likely to have been infected with an AGVd-like viroid. Twenty-three samples were infected with both HSVd and GYSVd, and one with the AGVd-like viroid, HSVd and GYSVd. This last sample had been collected from an old grapevine in Xinjiang. Infection in 13 samples positive by dotblot hybridization for HSVd and 12 for GYSVd was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) using the primers 5 ′ -TTGGATCCTCTCTTGA(G/A)CCCCT-3 ′ and 5 ′ -TTGGATCCGCGGCAGAGGC-3 ′ for HSVd; and 5 ′ TTGGATCCCACCTCGGAAGGCC(G/ T)CC-3 ′ and 5 ′ TTGGATCC(T/A) AACCACAGGAACCACA-3 ′ for GYSVd1 and GYSVd2. Identities of the Viroids were confirmed by sequencing the PCR products obtained. Infection of the sample positive when using the AFCVd probe could not be confirmed by RT-PCR using the primers 5 ′ -TTGGATCCTGGGCACCAACTAGAGGT-3 ′ and 5 ′ -TTGGATCCGGGCCTCC AAACAGGGAG-3 ′ , which should detect AGVd. The reason for this failure is not known and at present the identity of the viroid in this sample is uncertain. GYSVd has been reported from China previously (Hadidi et al ., 2003) but based solely on symptoms. This is the first report confirmed by other tests and is also the first report of HSVd in grapes in China.
T H Hung - One of the best experts on this subject based on the ideXlab platform.
-
a mutual titer enhancing relationship and similar localization patterns between citrus exocortis viroid and hop stunt viroid co infecting two citrus cultivars
Virology Journal, 2015Co-Authors: Mengling Wu, Tanglong Shen, T H HungAbstract:Citrus exocortis viroid (CEVd) and Hop stunt viroid (HSVd) are commonly found simultaneously infecting different citrus cultivars in Taiwan. A crucial question to be addressed is how accumulations of these two Viroids affect each other in an infected plant. In this study, we investigated the relationship between the two Viroids at macroscopic and microscopic levels. CEVd and HSVd titers were examined by real-time RT-PCR in 17 plants of two citrus cultivars (blood orange and Murcott mandarin) every 3 months (spring, summer, fall and winter) from 2011 to 2013. Three nonparametric tests (Spearman’s rank correlation coefficient, Kendall’s tau rank correlation coefficient and Hoeffding’s inequality) were performed to test the correlation between CEVd and HSVd. Cellular and subcellular localizations of the two Viroids were detected by digoxigenin- and colloidal gold-labeled in situ hybridization using light and transmission electron microscopy. The two Viroids were unevenly distributed in four different types of citrus tissues (rootstock bark, roots, twig bark and leaves). Compared with blood orange, Murcott mandarin was generally more susceptible to CEVd and HSVd infection. Both Viroids replicated and preferentially accumulated in the underground tissues of the two citrus cultivars. Except for blood orange at high temperatures, significant positive correlations were observed between the two Viroids in specific tissues of both cultivars. Relative to concentrations under single-infection conditions, the CEVd population significantly increased under double infection during half of the 12 monitored seasons; in contrast, the population of HSVd significantly increased under double infection during only one season. At cellular/subcellular levels, the two Viroids showed similar localization patterns in four tissues and the cells of these tissues in the two citrus cultivars. Our findings of titer enhancement, localization similarity, and lack of symptom aggravation under CEVd and HSVd double infection suggest that the two Viroids have a positive relationship in citrus. The combination of molecular and cellular techniques used in this study provided evidence of titer correlation and localization of co-infecting Viroids in the host. These methods may thus be useful tools for exploring viroid–viroid and viroid–host interactions.
-
multiplex detection distribution and genetic diversity of hop stunt viroid and citrus exocortis viroid infecting citrus in taiwan
Virology Journal, 2015Co-Authors: Mengling Wu, Tanglong Shen, T H HungAbstract:Background Two citrus Viroids, Citrus exocortis viroid (CEVd) and Hop stunt viroid (HSVd), have been reported and become potential threats to the citrus industry in Taiwan. The distributions and infection rates of two Viroids have not been investigated since the two diseases were presented decades ago. The genetic diversities and evolutionary relationships of two Viroids also remain unclear in the mix citrus planted region.
-
Multiplex detection, distribution, and genetic diversity of Hop stunt viroid and Citrus exocortis viroid infecting citrus in Taiwan
Virology Journal, 2015Co-Authors: Mengling Wu, Tanglong Shen, T H HungAbstract:Background Two citrus Viroids, Citrus exocortis viroid (CEVd) and Hop stunt viroid (HSVd), have been reported and become potential threats to the citrus industry in Taiwan. The distributions and infection rates of two Viroids have not been investigated since the two diseases were presented decades ago. The genetic diversities and evolutionary relationships of two Viroids also remain unclear in the mix citrus planted region. Methods Multiplex RT-PCR was used to detect the two Viroids for the first time in seven main cultivars of citrus. Multiplex real-time RT-PCR quantified the distributions of two Viroids in four citrus tissues. Sequence alignment and phylogenetic analysis were performed using the ClustalW and MEGA6 (neighbor-joining with p-distance model), respectively. Results HSVd was found more prevalent than CEVd (32.2% vs. 30.4%). Both CEVd and HSVd were commonly found simultaneously in the different citrus cultivars (up to 55%). Results of the multiplex quantitative analysis suggested that uneven distributions of both Viroids with twig bark as the most appropriate material for studies involving viroid sampling such as quarantine inspection. Sequence alignment against Taiwanese isolates, along with analysis of secondary structure, revealed the existence of 10 and 5 major mutation sites in CEVd and HSVd, respectively. The mutation sites in CEVd were located at both ends of terminal and variability domains, whereas those in HSVd were situated in left terminal and pathogenicity domains. A phylogenetic analysis incorporating worldwide viroid isolates indicated three and two clusters for the Taiwanese isolates of CEVd and HSVd, respectively. Conclusions Moderately high infection and co-infection rates of two Viroids in certain citrus cultivars suggest that different citrus cultivars may play important roles in viroid infection and evolution. These data also demonstrate that two multiplex molecular detection methods developed in the present study provide powerful tools to understand the genetic diversities among viroid isolates and quantify Viroids in citrus host. Our field survey can help clarify citrus-viroid relationships as well as develop proper prevention strategies.
