The Experts below are selected from a list of 321 Experts worldwide ranked by ideXlab platform
Hong Chen - One of the best experts on this subject based on the ideXlab platform.
-
detection of a new 20 bp insertion deletion indel within sheep prnd gene using Mathematical Expectation me method
Prion, 2017Co-Authors: Xichun Zhu, Xin Cao, Renyun Luo, Hong Chen, Xiuzhu Sun, Yong Cai, Xianyong LanAbstract:Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by Mathematical Expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.
-
application of Mathematical Expectation me strategy for detecting low frequency mutations an example for evaluating 14 bp insertion deletion indel within the bovine prnp gene
Prion, 2016Co-Authors: Qing Yang, Sihuan Zhang, Xinglei Qi, Weidong Qu, Xingshan Qi, Rongmin Wang, Hong ChenAbstract:ABSTRACTThe detection method based on the Mathematical Expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3′ untranslated region (3′ UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66....
-
application of Mathematical Expectation me strategy for detecting low frequency mutations an example for evaluating 14 bp insertion deletion indel within the bovine prnp gene
Prion, 2016Co-Authors: Qing Yang, Hong Chen, Sihuan Zhang, Rongmin Wang, Liangliang Liu, Xiukai Cao, Chuzhao Lei, Fengpeng Lin, Jiming Liu, Xianyong LanAbstract:The detection method based on the Mathematical Expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3' untranslated region (3' UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle.
Xianyong Lan - One of the best experts on this subject based on the ideXlab platform.
-
detection of a new 20 bp insertion deletion indel within sheep prnd gene using Mathematical Expectation me method
Prion, 2017Co-Authors: Xichun Zhu, Xin Cao, Renyun Luo, Hong Chen, Xiuzhu Sun, Yong Cai, Xianyong LanAbstract:Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by Mathematical Expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.
-
application of Mathematical Expectation me strategy for detecting low frequency mutations an example for evaluating 14 bp insertion deletion indel within the bovine prnp gene
Prion, 2016Co-Authors: Qing Yang, Hong Chen, Sihuan Zhang, Rongmin Wang, Liangliang Liu, Xiukai Cao, Chuzhao Lei, Fengpeng Lin, Jiming Liu, Xianyong LanAbstract:The detection method based on the Mathematical Expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3' untranslated region (3' UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle.
Qing Yang - One of the best experts on this subject based on the ideXlab platform.
-
application of Mathematical Expectation me strategy for detecting low frequency mutations an example for evaluating 14 bp insertion deletion indel within the bovine prnp gene
Prion, 2016Co-Authors: Qing Yang, Sihuan Zhang, Xinglei Qi, Weidong Qu, Xingshan Qi, Rongmin Wang, Hong ChenAbstract:ABSTRACTThe detection method based on the Mathematical Expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3′ untranslated region (3′ UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66....
-
application of Mathematical Expectation me strategy for detecting low frequency mutations an example for evaluating 14 bp insertion deletion indel within the bovine prnp gene
Prion, 2016Co-Authors: Qing Yang, Hong Chen, Sihuan Zhang, Rongmin Wang, Liangliang Liu, Xiukai Cao, Chuzhao Lei, Fengpeng Lin, Jiming Liu, Xianyong LanAbstract:The detection method based on the Mathematical Expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3' untranslated region (3' UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle.
Yingduo Han - One of the best experts on this subject based on the ideXlab platform.
-
Mathematical Expectation modeling of wide area controlled power systems with stochastic time delay
Power and Energy Society General Meeting, 2015Co-Authors: Xinran Zhang, Xiaoyu Wang, Yingduo HanAbstract:Communication network brings new challenges such as time delay and data loss to wide-area damping control of power systems. The uncertainty caused by stochastic time delay of network communication increases the difficulty of wide-area control performance analysis. This paper proposes a Mathematical Expectation modeling approach to model and analyze wide-area controlled power systems considering the effect of stochastic time delay. In the proposed method, Mathematical Expectation of stochastic time delay distribution is derived to accurately model the impact of communication network on wide-area control performance. The theoretical frame of the proposed modeling approach is presented and the effectiveness of the method is verified through the simulation of a power system with 8 generators and 36 nodes.
-
Mathematical Expectation modeling of wide area controlled power systems with stochastic time delay
IEEE Transactions on Smart Grid, 2015Co-Authors: Xinran Zhang, Xiaoyu Wang, Yingduo HanAbstract:Communication network brings new challenges such as time delay and data loss to wide-area damping control of power systems. The uncertainty caused by stochastic time delay of network communication increases the difficulty of wide-area control performance analysis. This paper proposes a Mathematical Expectation modeling approach to model and analyze wide-area controlled power systems considering the effect of stochastic time delay. In the proposed method, Mathematical Expectation of stochastic time delay distribution is derived to accurately model the impact of communication network on wide-area control performance. The theoretical frame of the proposed modeling approach is presented, and the effectiveness of the method is verified through the simulation of a power system with eight generators and 36 nodes.
Rongmin Wang - One of the best experts on this subject based on the ideXlab platform.
-
application of Mathematical Expectation me strategy for detecting low frequency mutations an example for evaluating 14 bp insertion deletion indel within the bovine prnp gene
Prion, 2016Co-Authors: Qing Yang, Sihuan Zhang, Xinglei Qi, Weidong Qu, Xingshan Qi, Rongmin Wang, Hong ChenAbstract:ABSTRACTThe detection method based on the Mathematical Expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3′ untranslated region (3′ UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66....
-
application of Mathematical Expectation me strategy for detecting low frequency mutations an example for evaluating 14 bp insertion deletion indel within the bovine prnp gene
Prion, 2016Co-Authors: Qing Yang, Hong Chen, Sihuan Zhang, Rongmin Wang, Liangliang Liu, Xiukai Cao, Chuzhao Lei, Fengpeng Lin, Jiming Liu, Xianyong LanAbstract:The detection method based on the Mathematical Expectation (ME) strategy is fast and accuracy for low frequency mutation screening in large samples. Previous studies have found that the 14-bp insertion/deletion (indel) variants of the 3' untranslated region (3' UTR) within bovine PRNP gene have been characterized with low frequency (≤5%) in global breeds outside China, which has not been determined in Chinese cattle breeds yet. Therefore, this study aimed to identify the 14-bp indel within PRNP gene in 5 major Chinese indigenous cattle breeds and to evaluate its associations with phenotypic traits. It was the first time to use ME strategy to detect low frequency indel polymorphisms and found that minor allele frequency was 0.038 (Qinchuan), 0.033 (Xianan), 0.013 (Nanyang), 0.003 (Jiaxian), and zero (Ji'an), respectively. Compared to the traditional detection method by which the sample was screened one by one, the reaction time by using the ME method was decreased 62.5%, 64.9%, 77.6%, 88.9% and 66.4%, respectively. In addition, the 14-bp indel was significantly associated with the growth traits in 2 cattle breeds, with the body length of Qinchuan cattle as well as the body weight and waistline of Xianan cattle. Our results have uncovered that the method based on ME strategy is rapid, reliable, and cost-effective for detecting the low frequency mutation as well as our findings provide a potential valuable theoretical basis for the marker-assisted selection (MAS) in beef cattle.
