The Experts below are selected from a list of 9783 Experts worldwide ranked by ideXlab platform
James M Coticchia - One of the best experts on this subject based on the ideXlab platform.
-
Adenoid reservoir for pathogenic biofilm bacteria
Journal of Clinical Microbiology, 2011Co-Authors: Laura Nistico, James M Coticchia, Rachael Kreft, Armin Gieseke, Amy Burrows, Pawjai Khampang, Y Liu, Joseph E Kerschner, J C PostAbstract:Biofilms of pathogenic bacteria are present on the middle ear mucosa of children with chronic otitis media (COM) and may contribute to the persistence of pathogens and the recalcitrance of COM to antibiotic treatment. Controlled studies indicate that Adenoidectomy is effective in the treatment of COM, suggesting that the Adenoids may act as a reservoir for COM pathogens. To investigate the bacterial community in the Adenoid, samples were obtained from 35 children undergoing Adenoidectomy for chronic OM or obstructive sleep apnea. We used a novel, culture-independent molecular diagnostic methodology, followed by confocal microscopy, to investigate the in situ distribution and organization of pathogens in the Adenoids to determine whether pathogenic bacteria exhibited criteria characteristic of biofilms. The Ibis T5000 Universal Biosensor System was used to interrogate the extent of the microbial diversity within Adenoid biopsy specimens. Using a suite of 16 broad-range bacterial primers, we demonstrated that Adenoids from both diagnostic groups were colonized with polymicrobial biofilms. Haemophilus influenzae was present in more Adenoids from the COM group (P = 0.005), but there was no significant difference between the two patient groups for Streptococcus pneumoniae or Staphylococcus aureus. Fluorescence in situ hybridization, lectin binding, and the use of antibodies specific for host epithelial cells demonstrated that pathogens were aggregated, surrounded by a carbohydrate matrix, and localized on and within the epithelial cell surface, which is consistent with criteria for bacterial biofilms.
-
biofilm surface area in the pediatric nasopharynx chronic rhinosinusitis vs obstructive sleep apnea
Archives of Otolaryngology-head & Neck Surgery, 2007Co-Authors: James M Coticchia, Giancarlo Zuliani, Crystal Coleman, Michael A Carron, Jose Gurrola, Michael Haupert, R S BerkAbstract:Objective To compare the percentage of mucosal surface area of Adenoids infected with biofilms removed from children with chronic rhinosinusitis (CRS) vs children with obstructive sleep apnea (OSA). Design Comparative microanatomical investigation of Adenoid mucosa from patients with CRS and OSA using scanning electron microscopy. Setting University-affiliated hospitals and ambulatory surgery center. Patients Four girls and 12 boys ranging in age from 3 months to 10 years. Main Outcome Measure Measurements of biofilm coverage of the entire Adenoidal surface. Results Adenoids removed from patients with CRS had dense mature biofilms covering the mucosal surface; they had a mean of 94.9% of their mucosal surface covered with mature biofilms, compared with a mean of 1.9% coverage on the Adenoids removed from patients with OSA. This difference was statistically significant at P Conclusions Adenoids removed from patients with CRS had almost their entire mucosal surface covered with biofilms vs scant coverage for patients with OSA. Biofilms in the nasopharynx of children with CRS may act as a chronic reservoir for bacterial pathogens resistant to standard antibiotics. The mechanical debridement of the nasopharyngeal biofilms may explain the observed clinical benefit associated with Adenoidectomy in this subset of pediatric patients.
-
identification of Adenoid biofilms in chronic rhinosinusitis
International Journal of Pediatric Otorhinolaryngology, 2006Co-Authors: Giancarlo Zuliani, Crystal Coleman, Michael A Carron, Jose Gurrola, Michael Haupert, R S Berk, James M CoticchiaAbstract:Summary Objective To compare the percent mucosal surface area of Adenoids removed from children with chronic rhinosinusitis (CRS) and those with obstructive sleep apnea (OSA) infected with biofilms. Design Comparative micro-anatomic investigation of Adenoid mucosa using scanning electron microscopy from patients with CRS and OSA. Subjects 4 females and 12 males ranging from 3 months to 10 years of age. Results Adenoids removed from patients with CRS had dense mature biofilms covering the mucosal surface. More specifically, Adenoids removed from patients with CRS had an average of 94.9% of their mucosal surface covered with mature biofilms vs. an average of 1.9% coverage on the Adenoids removed from patients with OSA. These differences were statistically significant at the p Conclusions It is well established that Adenoidectomy is useful in the treatment of CRS resistant to antibiotics. Adenoids removed from patients with CRS had almost their entire mucosal surface covered with biofilms vs. scant coverage for patients with OSA (p
J C Post - One of the best experts on this subject based on the ideXlab platform.
-
Adenoid reservoir for pathogenic biofilm bacteria
Journal of Clinical Microbiology, 2011Co-Authors: Laura Nistico, James M Coticchia, Rachael Kreft, Armin Gieseke, Amy Burrows, Pawjai Khampang, Y Liu, Joseph E Kerschner, J C PostAbstract:Biofilms of pathogenic bacteria are present on the middle ear mucosa of children with chronic otitis media (COM) and may contribute to the persistence of pathogens and the recalcitrance of COM to antibiotic treatment. Controlled studies indicate that Adenoidectomy is effective in the treatment of COM, suggesting that the Adenoids may act as a reservoir for COM pathogens. To investigate the bacterial community in the Adenoid, samples were obtained from 35 children undergoing Adenoidectomy for chronic OM or obstructive sleep apnea. We used a novel, culture-independent molecular diagnostic methodology, followed by confocal microscopy, to investigate the in situ distribution and organization of pathogens in the Adenoids to determine whether pathogenic bacteria exhibited criteria characteristic of biofilms. The Ibis T5000 Universal Biosensor System was used to interrogate the extent of the microbial diversity within Adenoid biopsy specimens. Using a suite of 16 broad-range bacterial primers, we demonstrated that Adenoids from both diagnostic groups were colonized with polymicrobial biofilms. Haemophilus influenzae was present in more Adenoids from the COM group (P = 0.005), but there was no significant difference between the two patient groups for Streptococcus pneumoniae or Staphylococcus aureus. Fluorescence in situ hybridization, lectin binding, and the use of antibodies specific for host epithelial cells demonstrated that pathogens were aggregated, surrounded by a carbohydrate matrix, and localized on and within the epithelial cell surface, which is consistent with criteria for bacterial biofilms.
R S Berk - One of the best experts on this subject based on the ideXlab platform.
-
biofilm surface area in the pediatric nasopharynx chronic rhinosinusitis vs obstructive sleep apnea
Archives of Otolaryngology-head & Neck Surgery, 2007Co-Authors: James M Coticchia, Giancarlo Zuliani, Crystal Coleman, Michael A Carron, Jose Gurrola, Michael Haupert, R S BerkAbstract:Objective To compare the percentage of mucosal surface area of Adenoids infected with biofilms removed from children with chronic rhinosinusitis (CRS) vs children with obstructive sleep apnea (OSA). Design Comparative microanatomical investigation of Adenoid mucosa from patients with CRS and OSA using scanning electron microscopy. Setting University-affiliated hospitals and ambulatory surgery center. Patients Four girls and 12 boys ranging in age from 3 months to 10 years. Main Outcome Measure Measurements of biofilm coverage of the entire Adenoidal surface. Results Adenoids removed from patients with CRS had dense mature biofilms covering the mucosal surface; they had a mean of 94.9% of their mucosal surface covered with mature biofilms, compared with a mean of 1.9% coverage on the Adenoids removed from patients with OSA. This difference was statistically significant at P Conclusions Adenoids removed from patients with CRS had almost their entire mucosal surface covered with biofilms vs scant coverage for patients with OSA. Biofilms in the nasopharynx of children with CRS may act as a chronic reservoir for bacterial pathogens resistant to standard antibiotics. The mechanical debridement of the nasopharyngeal biofilms may explain the observed clinical benefit associated with Adenoidectomy in this subset of pediatric patients.
-
identification of Adenoid biofilms in chronic rhinosinusitis
International Journal of Pediatric Otorhinolaryngology, 2006Co-Authors: Giancarlo Zuliani, Crystal Coleman, Michael A Carron, Jose Gurrola, Michael Haupert, R S Berk, James M CoticchiaAbstract:Summary Objective To compare the percent mucosal surface area of Adenoids removed from children with chronic rhinosinusitis (CRS) and those with obstructive sleep apnea (OSA) infected with biofilms. Design Comparative micro-anatomic investigation of Adenoid mucosa using scanning electron microscopy from patients with CRS and OSA. Subjects 4 females and 12 males ranging from 3 months to 10 years of age. Results Adenoids removed from patients with CRS had dense mature biofilms covering the mucosal surface. More specifically, Adenoids removed from patients with CRS had an average of 94.9% of their mucosal surface covered with mature biofilms vs. an average of 1.9% coverage on the Adenoids removed from patients with OSA. These differences were statistically significant at the p Conclusions It is well established that Adenoidectomy is useful in the treatment of CRS resistant to antibiotics. Adenoids removed from patients with CRS had almost their entire mucosal surface covered with biofilms vs. scant coverage for patients with OSA (p
Alf A Lindberg - One of the best experts on this subject based on the ideXlab platform.
-
persistence of nontypeable haemophilus influenzae in Adenoid macrophages a putative colonization mechanism
Acta Oto-laryngologica, 1996Co-Authors: Joachim Forsgren, Anders Samuelson, Silvia Borrelli, Birger Christensson, J Jonasson, Alf A LindbergAbstract:That nontypeable H. influenzae (NTHI) can reside intracellularly in human Adenoid tissue has been suggested by use of in situ hybridization of a fluorescein labelled 16S rRNA-targeted oligonucleotide probe (FISH). Adenoid tissues from 43 children operated on in a clinically infection-free interval were investigated. FISH revealed H. influenzae in macrophage-like cells, located subepithelially in the crypts in all 43 Adenoids. Furthermore, H. influenzae was detected in 22/22 Adenoids using immunohistochemistry with the monoclonal antibody MAHI-3 recognizing a conserved H. influenzae LPS inner-core region. FISH and staining with monoclonal antibodies against immunophenotypic markers were performed simultaneously in order to characterize the cellular interrelations in this microenvironment. The findings of widespread presence of H. influenzae in cells of which some strongly expressed the CD14 marker of the monocyte/macrophage lineage may correspond to an important aspect of the colonization mechanisms whereby NTHI persists in the nasopharynx of children.
-
haemophilus influenzae resides and multiplies intracellularly in human Adenoid tissue as demonstrated by in situ hybridization and bacterial viability assay
Infection and Immunity, 1994Co-Authors: Joachim Forsgren, Anders Samuelson, J Jonasson, A Ahlin, Britta Rynneldagoo, Alf A LindbergAbstract:The DNA oligomer 59-d(TGCGGCCTCTCAGTCCCGCACTTTCATCTTCC)-39 specifically recognizes Haemophilus influenzae 16S rRNA. We report here the use of this oligonucleotide, with a fluorescein label tagged on its 59 end, as a probe for the in situ detection of nonencapsulated nontypeable H. influenzae in sections of Adenoid tissue from 10 children who were clinically infection free but were having their Adenoids removed because of nasal obstruction. In some cases, the reticular crypt epithelium was focally infiltrated by H. influenzae. The reservoir for these bacterial colonizations, in all likelihood long standing, seemed to be macrophage-like cells found in the subepithelial layers in all 10 cases. These mononuclear cells contained up to 200 intracellular H. influenzae cells. In the transmission electron macroscope, macrophage-like cells with intracellular bacteria with coccoid morphology, at least some of which were dividing, were seen. Adenoid cell suspensions, enriched for macrophages by use of paramagnetic beads coated with monoclonal antibodies against the CD14 marker, yielded up to 1,100 CFU of nontypeable H. influenzae per 10(5) cells after killing of extracellular bacteria with gentamicin followed by mechanical lysis of the cells.
Jihyeon Shin - One of the best experts on this subject based on the ideXlab platform.
-
is there an association between vitamin d deficiency and adenotonsillar hypertrophy in children with sleep disordered breathing
BMC Pediatrics, 2018Co-Authors: Jihyeon ShinAbstract:Low vitamin D levels have been linked to the risk of sleep-disordered breathing (SDB) in children. Although adenotonsillar hypertrophy (ATH) is the major contributor to childhood SDB, the relationship between ATH and serum vitamin D is uncertain. We therefore investigated the relationship between vitamin D levels and associated factors in children with ATH. We reviewed data from all children with SDB symptoms who were treated from December 2013 to February 2014. Of these, 88 children whose serum vitamin D levels were measured were enrolled in the study. We divided the children into four groups based on Adenoidal and/or tonsillar hypertrophy. We conducted a retrospective chart review to analyze demographic data, the sizes of tonsils and Adenoids, serum 25-hydroxy-vitamin D [25(OH)D] level, body mass index (BMI), and allergen sensitization patterns. Children in the ATH group had a lower mean 25(OH)D level than did those in the control group (p < 0.05). Children with vitamin D deficiencies exhibited markedly higher frequencies of Adenoidal and/or tonsillar hypertrophy than did those with sufficient vitamin D (p < 0.05). Spearman’s correlation analysis identified an inverse correlation between serum 25(OH)D levels and age, tonsil and Adenoid size, and height (all p < 0.05). In a multiple regression analysis, tonsil and Adenoid size as well as BMI-z score, were associated with 25(OH)D levels after controlling for age, sex, height, and mite sensitization (p < 0.05). Our results suggest that low vitamin D levels are linked to ATH. Both the sizes of the Adenoids and tonsils and the BMI-z score were associated with the 25(OH)D level. Therefore, measurement of the serum 25(OH)D level should be considered in children with ATH and SDB symptoms.