Ancylostoma Ceylanicum - Explore the Science & Experts | ideXlab

Scan Science and Technology

Contact Leading Edge Experts & Companies

Ancylostoma Ceylanicum

The Experts below are selected from a list of 249 Experts worldwide ranked by ideXlab platform

Ancylostoma Ceylanicum – Free Register to Access Experts & Abstracts

Michael Cappello – One of the best experts on this subject based on the ideXlab platform.

  • Hamsters vaccinated with Ace-mep-7 DNA vaccine produced protective immunity against Ancylostoma Ceylanicum infection.
    Experimental parasitology, 2016
    Co-Authors: Marcin Wiśniewski, Michael Cappello, Ewa Długosz, Sławomir Jaros, Piotr Bąska, Halina Wędrychowicz
    Abstract:

    Hookworms are intestinal nematodes that infect up to 740 million people, mostly in tropical and subtropical regions. Adult worms suck blood from damaged vessels in the gut mucosa, digesting hemoglobin using aspartic-, cysteine– and metalloproteases. Targeting aspartic hemoglobinases using drugs or vaccines is therefore a promising approach to ancylostomiasis control. Based on homology to metalloproteases from other hookworm species, we cloned the Ancylostoma Ceylanicum metalloprotease 7 cDNA (Ace-mep-7). The corresponding Ace-MEP-7 protein has a predicted molecular mass of 98.8 kDa. The homology to metallopeptidases from other hookworm species and its predicted transmembrane region support the hypothesis that Ace-MEP-7 may be involved in hemoglobin digestion in the hookworm gastrointestinal tract, especially that our analyses show expression of Ace-mep-7 in the adult stage of the parasite. Immunization of Syrian golden hamsters with Ace-mep-7 cDNA resulted in 50% (p < 0.01) intestinal worm burden reduction. Additionally 78% (p < 0.05) egg count reduction in both sexes was observed. These results suggest that immunization with Ace-mep-7 may contribute to reduction in egg count released into the environment during the A. Ceylanicum infection.

  • Ancylostoma Ceylanicum metalloprotease 6 DNA vaccination induces partial protection against hookworm challenge infection
    Acta Parasitologica, 2013
    Co-Authors: Marcin Wiśniewski, Michael Cappello, Sławomir Jaros, Piotr Bąska, Halina Wędrychowicz
    Abstract:

    Hookworms are blood feeding intestinal nematodes that infect more than 500 million people and cause iron deficiency anemia. Infected children suffer from physical and cognitive growth retardation. Because of potential anthelminthic drug resistance, the need for vaccine development is urgent. Numerous antigens have been tested in animal models as vaccines against hookworm infection, but there is no effective human vaccine. We cloned a cDNA encoding Ancylostoma Ceylanicum metalloprotease 6 ( Acemep-6 ). Ace-MEP-6 is a protein with a predicted molecular mass of 101.87 kDa and based on computational analysis it is very likely to be engaged in food processing via hemoglobin digestion. Groups of hamsters were immunized with an Ace-mep-6 cDNA vaccine, either once or three times. Animals that were administered one dose developed high resistance (80%, p < 0.01) against challenge infection, whereas triple immunization resulted in no worm burden reduction. These results suggest that DNA vaccines can be powerful tools in ancylostomiasis control, although the mechanisms through which protection is conferred remain unclear.

  • Peroxiredoxin-1 from the Human Hookworm Ancylostoma Ceylanicum Forms a Stable Oxidized Decamer and Is Covalently Inhibited by Conoidin A
    Chemistry & biology, 2013
    Co-Authors: Jennifer B. Nguyen, Michael Cappello, David L. Williams, Jon J. Vermeire, Christopher D. Pool, Christina Y.b. Wong, Rebecca S. Treger, Wendy A. Lea, Anton Simeonov, Yorgo Modis
    Abstract:

    Summary Hookworms are parasitic nematodes that have a devastating impact on global health, particularly in developing countries. We report a biochemical and structural analysis of a peroxiredoxin from the hookworm Ancylostoma Ceylanicum , AcePrx-1. Peroxiredoxins provide antioxidant protection and act as signaling molecules and chaperones. AcePrx-1 is expressed in adult hookworms and can be inactivated by 2,3-bis(bromomethyl)quinoxaline-1,4-dioxide (conoidin A). Conoidin A inactivates AcePrx-1 by alkylating or crosslinking the catalytic cysteines, while maintaining the enzyme in the “locally unfolded” conformation. Irreversible oxidation of the resolving cysteine may contribute additional inhibitory activity. A crystal structure of oxidized AcePrx-1 reveals a disulfide-linked decamer. A helix macrodipole near the active site increases the reactivity of the catalytic cysteines to conoidin A. This work demonstrates the promise of conoidin compounds as probes to evaluate peroxiredoxins as drug targets in human parasites.

Rebecca J. Traub – One of the best experts on this subject based on the ideXlab platform.

  • Efficacy of single topical treatment of Selamectin (Revolution®) against Ancylostoma Ceylanicum in experimentally infected cats.
    Veterinary parasitology regional studies and reports, 2019
    Co-Authors: Piyanan Taweethavonsawat, Thitirat Chaimee, Patcharin Priyavoravong, Rebecca J. Traub
    Abstract:

    Ancylostoma Ceylanicum, a species of hookworm, is a common parasite of dogs and cats in the Asia-Pacific region. The objective of this study was to determine the efficacy of a single topical treatment of selamectin (Revolution®) against A. Ceylanicum in experimentally infected cats. 12 kittens were injected with 300 infective stage larvae (L3) of A. Ceylanicum by the subcutaneous route. Faecal samples were examined daily (days 7-15) for the presence of hookworm eggs. On day 18 kittens were stratified by faecal egg count and randomly allocated in equal numbers to control (n = 6) and treatment (n = 6) groups. Faecal egg counts were then performed daily (days 14-27) or every 3 days (days 28-51) until the end of the study and compared between the treated and control groups. Kittens in the treatment group were administered a single topical dose of selamectin (Revolution®), per label recommendations (6 mg/kg), on day 19. Kittens in the control group were not treated. At 4 days post-treatment, no hookworm eggs were detected in the treated group. Faecal samples from this group remained negative throughout the study, the treatment efficacy was 100% egg reduction (P 

  • Ancylostoma Ceylanicum Hookworm in the Solomon Islands
    Emerging infectious diseases, 2017
    Co-Authors: Richard S. Bradbury, Sze Fui Hii, Humpress Harrington, Richard Speare, Rebecca J. Traub
    Abstract:

    Although hookworm is highly prevalent in the Solomon Islands, the species involved are unknown. We initiated this study in response to finding Ancylostoma Ceylanicum hookworm in a peacekeeper in Australia who had returned from the Solomon Islands. Kato-Katz fecal surveys performed in 2013 and 2014 in 2 village groups in East Malaita, Solomon Islands, identified hookworm-positive samples. These specimens were tested by cytochrome oxidase 1 (cox-1) gene multiplex PCR and sequenced. Of 66 positive specimens, 54 (81.8%) contained only Necator americanus, 11 (16.7%) contained only A. Ceylanicum, and 1 (1.5%) contained both species. A. duodenale was not found. Haplotype analysis of cox-1 sequences placed all human isolates (99% bootstrap support) of A. Ceylanicum within the zoonotic clade rather than the human-specific clade. This study confirms that A. Ceylanicum is endemic in the East Malaita region of this Pacific Island nation. The strain of the A. Ceylanicum in this region can be shared among humans, dogs, and cats.

  • Ancylostoma Ceylanicum, a re-emerging but neglected parasitic zoonosis.
    International journal for parasitology, 2013
    Co-Authors: Rebecca J. Traub
    Abstract:

    Although Ancylostoma Ceylanicum is known to be an endemic and widely distributed hookworm of dogs and cats in Asia, its contribution to human morbidity as a potentially zoonotic hookworm remains largely unexplored. Since its discovery by Lane (1913) as a ‘new parasite‘ of humans a century ago, the hookworm has been regarded as a ‘rare’ and ‘abnormal’ parasite and largely overlooked in surveys of human parasites. Recent molecular-based surveys in Asia, however, have demonstrated that A. Ceylanicum is the second most common hookworm species infecting humans, comprising between 6% and 23% of total patent hookworm infections. In experimentally induced infections, A. Ceylanicum mimics the clinical picture produced by the anthroponotic hookworms of ‘ground itch’ and moderate to severe abdominal pain in the acute phase. Natural infections with A. Ceylanicum in humans have been reported in almost all geographical areas in which the hookworm is known to be endemic in dogs and cats, however for the majority of reports, no clinical data are available. Much like the anthroponotic hookworm species, patent A. Ceylanicum adults can isolate within the jejunum to produce chronic infections that on occasion, may occur in high enough burdens to produce anaemia. In addition, the hookworm can act much like Ancylostoma caninum and be found lower in the gastrointestinal tract leading to abdominal distdistension and pain, diarrhoea and occult blood in the faeces accompanied by peripheral eosinophilia. Whether A. Ceylanicum is capable of producing both classical hookworm disease and evoking morbidity through an uncontrolled allergic response in some individuals remains unascertained. Future investigations combining the use of molecular diagnostic tools with clinical and pathological data will shed further light on its role as a human pathogen. The control of this zoonosis necessitates an integrated and inter-sectorial “One Health” approach be adopted in communities where large numbers of dogs share a close relationship with humans.

Raffi V Aroian – One of the best experts on this subject based on the ideXlab platform.

  • Cognitive and Microbiome Impacts of Experimental Ancylostoma Ceylanicum Hookworm Infections in Hamsters
    Scientific reports, 2019
    Co-Authors: Samuel C. Pan, Doyle V. Ward, Yunqiang Yin, Mostafa A. Elfawal, Robert E. Clark, Raffi V Aroian
    Abstract:

    Hookworms are one of the most prevalent and important parasites, infecting ~500 million people worldwide. Hookworm disease is among the leading causes of iron-deficiency anemia in the developing world and is associated with significant growth stunting and malnutrition. In humans, hookworms appear to impair memory and other forms of cognition, although definitive data are hard to come by. Here we study the impact of a human hookworm parasite, Ancylostoma Ceylanicum, on cognition in hamsters in a controlled laboratory setting. We developed tests that measure long-term memory in hamsters. We find that hookworm-infected hamsters were fully capable of detecting a novel object. However, hookworm-infected hamsters were impaired in detecting a displaced object. Defects could be discerned at even at low levels of infection, whereas at higher levels of infection, hamsters were statistically unable to distinguish between displaced and non-displaced objects. These spatial memory deficiencies could not be attributed to defects in infected hamster mobility or to lack of interest. We also found that hookworm infection resulted in reproducible reductions in diversity and changes in specific taxanomic groups in the hamster gut microbiome. These data demonstrate that human hookworm infection in a laboratory mammal results in a specific, rapid, acute, and measurable deficit in spatial memory, and we speculate that gut alterations could play some role in these cognitive deficits. Our findings highlight the importance of hookworm elimination and suggest that finer tuned spatial memory studies be carried out in humans.

  • The genome and transcriptome of the zoonotic hookworm Ancylostoma Ceylanicum identify infection-specific gene families
    Nature Genetics, 2015
    Co-Authors: Erich M Schwarz, Igor Antoshechkin, Melanie M Miller, Paul W Sternberg, Raffi V Aroian
    Abstract:

    Hookworms infect over 400 million people, stunting and impoverishing them^ 1 , 2 , 3 . Sequencing hookworm genomes and finding which genes they express during infection should help in devising new drugs or vaccines against hookworms^ 4 , 5 . Unlike other hookworms, Ancylostoma Ceylanicum infects both humans and other mammals, providing a laboratory model for hookworm disease^ 6 , 7 . We determined an A. Ceylanicum genome sequence of 313 Mb, with transcriptomic data throughout infection showing expression of 30,738 genes. Approximately 900 genes were upregulated during early infection in vivo , including ASPRs, a cryptic subfamily of activation-associated secreted proteins (ASPs)^ 8 . Genes downregulated during early infection included ion channels and G protprotein–coupled receptors; this downregulation was observed in both parasitic and free-living nematodes. Later, at the onset of heavy blood feeding, C-lectin genes were upregulated along with genes for secreted clade V proteins (SCVPs), encoding a previously undescribed protein family. These findings provide new drug and vaccine targets and should help elucidate hookworm pathogenesis. Erich Schwarz and colleagues report whole-genome sequencing of the zoonotic hookworm Ancylostoma Ceylanicum . They also analyze the transcriptome through the course of infection in golden hamsters and identify groups of genes showing differential regulation across different stages.

  • The genome and transcriptome of the zoonotic hookworm Ancylostoma Ceylanicum identify infection-specific gene families
    Nature genetics, 2015
    Co-Authors: Erich M Schwarz, Igor Antoshechkin, Melanie M Miller, Paul W Sternberg, Raffi V Aroian
    Abstract:

    Hookworms infect over 400 million people, stunting and impoverishing them. Sequencing hookworm genomes and finding which genes they express during infection should help in devising new drugs or vaccines against hookworms. Unlike other hookworms, Ancylostoma Ceylanicum infects both humans and other mammals, providing a laboratory model for hookworm disease. We determined an A. Ceylanicum genome sequence of 313 Mb, with transcriptomic data throughout infection showing expression of 30,738 genes. Approximately 900 genes were upregulated during early infection in vivo, including ASPRs, a cryptic subfamily of activation-associated secreted proteins (ASPs). Genes downregulated during early infection included ion channels and G protprotein-coupled receptors; this downregulation was observed in both parasitic and free-living nematodes. Later, at the onset of heavy blood feeding, C-lectin genes were upregulated along with genes for secreted clade V proteins (SCVPs), encoding a previously undescribed protein family. These findings provide new drug and vaccine targets and should help elucidate hookworm pathogenesis.

Lisa M. Harrison – One of the best experts on this subject based on the ideXlab platform.

  • Characterisation of a fatty acid and retinol binding protein orthologue from the hookworm Ancylostoma Ceylanicum.
    International journal for parasitology, 2009
    Co-Authors: Keke C. Fairfax, Lisa M. Harrison, Richard D. Bungiro, Jon J. Vermeire, Wayne M. Grant, Sohail Z. Husain, Michael Cappello
    Abstract:

    Abstract Hookworms, bloodfeeding intestinal nematodes, infect nearly one billion people in resource limited countries and are a leading cause of anaemia and malnutrition. Like other nematodes, hookworms lack the capacity to synthesise essential fatty acids de novo and therefore must acquire those from exogenous sources. The cDNA corresponding to a putative Ancylostoma Ceylanicum fatty acid and retinol bindbinding protprotein-1 (AceFAR-1) was amplified from adult hookworm mRNA. Studies using quantitative reverse trantranscriptase real-time PCR demonstrate that AceFAR-1 transcripts are most abundant in the earliest developmental stages of the parasite, and greater in females than males. Using in vitro assays, the recombinant AceFAR-1 (rAceFAR-1) was shown to bind individual fatty acids with equilibrium dissociation constants in the low micromolar range. The pattern of fatty acid uptake by live adult worms cultured ex vivo was similar to the in vitro binding profile of rAceFAR-1, raising the possibility that the native protprotein may be involved in acquisition of fatty acids by A. Ceylanicum . Animals vaccinated orally with rAceFAR-1 and the mucosal adjuvant cholera toxin exhibited a statistically significant (40–47%) reduction in intestinal worm burden compared with controls immunized with antigen or adjuvant alone. Together, these data suggest a potential role for AceFAR-1 in hookworm biology, making it a potentially valuable target for drug and vaccine development.

  • Molecular cloning and characterization of a C-type lectin from Ancylostoma Ceylanicum: evidence for a role in hookworm reproductive physiology.
    Molecular and biochemical parasitology, 2006
    Co-Authors: Allison C. Brown, Lisa M. Harrison, Wadim Kapulkin, Brian F. Jones, Anindita Sinha, Amy F. Savage, Nicholas Villalon, Michael Cappello
    Abstract:

    Lectins comprise a family of related proteins that mediate essential cell functions through binding to carbohydrates. Within this protein family, C-type lectins are defined by the requirement of calcium for optimal biologic activity. Using reverse transcription PCR, a cDNA corresponding to a putative C-type lectin has been amplified from the hookworm parasite Ancylostoma Ceylanicum. The 550 nucleotide open reading frame of the Ancylostoma Ceylanicum C-type Lectin-1 (AceCTL-1) cDNA corresponds to a 167 amino acid mature protein (18706 Da) preceded by a 17 amino acid secretory signal sequence. The recombinant protein (rAceCTL-1) was expressed in Drosophila S2 cells and purified using a combination of affinity chromatography and reverse phase HPLC. Using in vitro carbohydrate binding studies, it was determined that rAceCTL-1 binds N-acetacetyllD-glucosamine, a common component of eukaryotic egg cell membranes. Using a polyclonal IgG raised against the recombinant protein, the native AceCTL-1 was identified in sperm and soluble protein extracts of adult male A. Ceylanicum by immunoblot. Probing of adult hookworm sections with the polyclonal IgG demonstrated localization to the testes in males, as well as the spermatheca and developing embryos in females, consistent with its role as a sperm protein. Together, these data strongly suggest that AceCTL-1 is a male gender-specific C-type lectin with a function in hookworm reproductive physiology.

  • Ancylostoma Ceylanicum: Exsheathment is not required for successful cryopreservation of third stage hookworm larvae
    American Journal of Tropical Medicine and Hygiene, 2003
    Co-Authors: John Duarte, Lisa M. Harrison, Michael Cappello
    Abstract:

    Third-stage larvae (L3) of the human hookworm parasite Ancylostoma Ceylanicum were cultured from the feces of infected hamsters and frozen for up to 100 days in liquid nitrogen. Upon thawing, viable larvae were recovered and used to inoculate naive hamsters. The larvae recovered from this second group of hamsters were used to inoculate a third group of naive animals, which demonstrated that the originally frozen larvae were successfully maintained for two full generations following thawing. These data suggest that exsheathment, which has previously been reported to be essential for successful cryopreservation, is not necessary for recovery of viable, infectious A. Ceylanicum L3.

Jerzy M Behnke – One of the best experts on this subject based on the ideXlab platform.

  • Recombinant DNA resources for the comparative genomics of Ancylostoma Ceylanicum.
    , 2016
    Co-Authors: Wadim J. Kapulkin, Jerzy M Behnke, Adriana Magalska, Ewa Janecka, Arkadiusz Ciesielski, Malgorzata Lobocka, Halina Wedrychowicz
    Abstract:

    We describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm, Ancylostoma Ceylanicum. First, with the improved methodology, we generated sets of SL1 (5′- linker – GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening, we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematode C. elegans and A. Ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organism C. elegans and closely related parasitic species. We discuss the potential and relevance of Ancylostoma Ceylanicum data and resources generated by the recombinant DNA approach.

  • Expression of acquired immunity to the hookworm Ancylostoma Ceylanicum in hamsters.
    Parasite immunology, 1997
    Co-Authors: Jerzy M Behnke, Josephine Guest, Richard A Rose
    Abstract:

    Four experiments are described in which hamsters, initially exposed to primary infection with Ancylostoma Ceylanicum, were given a homologous challenge and components of the secondary response were quantified and compared to relevant control groups. The initial establishment of the L3 larvae was not prevented in immunized hamsters but their growth was slowed and virtually all larvae were lost within a week of challenge, when the majority were still at the L4 stage of development. The loss of worms was associated with an accelerated mucosal mastocytosis and increased systemic antibody. Thus acquired immunity to hookworm larvae in this system acted on L3 and L4 stages, thereby preventing larvae from maturing in immunized animals. In contrast to primary infections, immunized hamsters responding to a challenge infection did not lose weight nor did they experience significant anaemia, because of the lack of adult worms. The secondary immune responses therefore prevented manifestation of hookworm disease among immunized-challenged animals.

  • in vitro studies on the relative sensitivity to ivermectin of necator americanus and Ancylostoma Ceylanicum
    International Journal for Parasitology, 1995
    Co-Authors: J C Richards, Jerzy M Behnke, Ian R Duce
    Abstract:

    Abstract Experiments were carried out to compare the sensitivity of Ancylostoma Ceylanicum and Necator americanus to ivermectin (IVM) and pyrantel in vitro . Loss of motility and inhibition of ingestion by IVM were compared and A. Ceylanicum was found to be approximately 40–50 times more sensitive to IVM than N. americanus . Both species showed a similar sensitivity to pyrantel. Uptake of [ 3 H]IVM across the cuticle was compared and shown to be unlikely to account for the differences in sensitivity to IVM between the two species.