The Experts below are selected from a list of 3384 Experts worldwide ranked by ideXlab platform
Q Wei - One of the best experts on this subject based on the ideXlab platform.
-
a polymerase chain reaction protocol for the detection of Clavibacter xyli subsp xyli the causal bacterium of sugarcane ratoon stunting disease
Plant Disease, 1998Co-Authors: Yongbao Pan, M P Grisham, D M Burner, K E Damann, Q WeiAbstract:A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.
Marie-agnès Jacques - One of the best experts on this subject based on the ideXlab platform.
-
Comparative Genomics and Phylogenetic Analyses Suggest Several Novel Species within the Genus Clavibacter, Including Nonpathogenic Tomato-Associated Strains.
Applied and environmental microbiology, 2020Co-Authors: Ebrahim Osdaghi, Perrine Portier, Martial Briand, Touraj Rahimi, S. Mohsen Taghavi, Maryam Ansari, Sadegh Zarei, Marie-agnès JacquesAbstract:ABSTRACT Members of the genus Clavibacter are economically important bacterial plant pathogens infecting a set of diverse agricultural crops (e.g., alfalfa, corn, potato, tomato, and wheat). Tomato-associated Clavibacter sp. strains account for a great portion of the genetic diversity of the genus, and C. michiganensissensu stricto (formerly C. michiganensis subsp. michiganensis), causing bacterial canker disease, is considered one of the most destructive seed-borne agents for the crop worldwide. However, current taxonomic descriptions of the genus do not reflect the existing diversity of the strains, resulting in unsatisfactory results in quarantine surveys for the pathogens. In this study, we used all the available genome sequences of Clavibacter sp. strains, including the type strains of newly described subspecies, to provide precise insight into the diversity of tomato-associated members of the genus and further clarify the taxonomic status of the strains using genotypic and phenotypic features. The results of phylogenetic analyses revealed the existence of nine hypothetical new species among the investigated strains. None of the three new subspecies (i.e., C. michiganensis subsp. californiensis, C. michiganensis subsp. chilensis, and C. michiganensis subsp. phaseoli) is included within the tomato-pathogenic C. michiganensissensu stricto lineage. Although comparative genomics revealed the lack of chp and tomA pathogenicity determinant gene clusters in the nonpathogenic strains, a number of pathogenicity-related genes were noted to be present in all the strains regardless of their pathogenicity characteristics. Altogether, our results indicate a need for a formal taxonomic reconsideration of tomato-associated Clavibacter sp. strains to facilitate differentiation of the lineages in quarantine inspections. IMPORTANCEClavibacter spp. are economically important bacterial plant pathogens infecting a set of diverse agricultural crops, such as alfalfa, corn, pepper, potato, tomato, and wheat. A number of plant-pathogenic members of the genus (e.g., C. michiganensissensu stricto and C. sepedonicus, infecting tomato and potato plants, respectively) are included in the A2 (high-risk) list of quarantine pathogens by the European and Mediterranean Plant Protection Organization (EPPO). Although tomato-associated members of Clavibacter spp. account for a significant portion of the genetic diversity in the genus, only the strains belonging to C. michiganensissensu stricto (formerly C. michiganensis subsp. michiganensis) cause bacterial canker disease of tomato and are subjected to the quarantine inspections. Hence, discrimination between the pathogenic and nonpathogenic Clavibacter sp. strains associated with tomato seeds and transplants plays a pivotal role in the accurate detection and cost-efficient management of the disease. On the other hand, detailed information on the genetic contents of different lineages of the genus would lead to the development of genome-informed specific detection techniques. In this study, we have provided an overview of the phylogenetic and genomic differences between the pathogenic and nonpathogenic tomato-associated Clavibacter sp. strains. We also noted that the taxonomic status of newly introduced subspecies of C. michiganensis (i.e., C. michiganensis subsp. californiensis, C. michiganensis subsp. chilensis, and C. michiganensis subsp. phaseoli) should be reconsidered.
-
Comparative Genomics to Develop a Specific Multiplex PCR Assay for Detection of Clavibacter michiganensis.
Phytopathology, 2020Co-Authors: Shree P. Thapa, Marie-agnès Jacques, Michael O’leary, Robert L. Gilbertson, Gitta CoakerAbstract:Clavibacter michiganensis is a Gram-positive bacterial pathogen that proliferates in the xylem vessels of tomato, causing bacterial wilt and canker symptoms. Accurate detection is a crucial step in confirming outbreaks of bacterial canker and developing management strategies. A major problem with existing detection methods are false-positive and -negative results. Here, we report the use of comparative genomics of 37 diverse Clavibacter strains, including 21 strains sequenced in this study, to identify specific sequences that are C. michiganensis detection targets. Genome-wide phylogenic analyses revealed additional diversity within the genus Clavibacter. Pathogenic C. michiganensis strains varied in plasmid composition, highlighting the need for detection methods based on chromosomal targets. We utilized sequences of C. michiganensis-specific loci to develop a multiplex PCR-based diagnostic platform using two C. michiganensis chromosomal genes (rhuM and tomA) and an internal control amplifying both bacterial and plant DNA (16s ribosomal RNA). The multiplex PCR assay specifically detected C. michiganensis strains from a panel of 110 additional bacteria, including other Clavibacter spp. and bacterial pathogens of tomato. The assay was adapted to detect the presence of C. michiganensis in seed and tomato plant materials with high sensitivity and specificity. In conclusion, the described method represents a robust, specific tool for detection of C. michiganensis in tomato seed and infected plants.
-
Comparative Genomics and Phylogenetic Analyses Suggest Several Novel Species within Clavibacter sp. Including Non-Pathogenic Tomato-Associated Strains
Applied and Environmental Microbiology, 2020Co-Authors: Ebrahim Osdaghi, Perrine Portier, Martial Briand, Touraj Rahimi, S. Mohsen Taghavi, Maryam Ansari, Sadegh Zarei, Marie-agnès JacquesAbstract:Members of Clavibacter spp. are economically important bacterial plant pathogens infecting a set of diverse agricultural crops (e.g. alfalfa, corn, potato, tomato, and wheat). Tomato-associated Clavibacter spp. strains occupy a great portion of genetic diversity of the genus, and C. michiganensis sensu stricto (formerly C.michiganensis subsp. michiganensis) causing bacterial canker disease considered one of the destructive seed-borne agents of the crop worldwide. However, current taxonomic descriptions of the genus do not reflect the existing diversity of the strains, resulting in unsatisfactory consequences in quarantine surveys for the pathogens. In this study, we used all the available genome sequences of Clavibacter spp. strains − including the type strains of newly described subspecies − to provide a precise insight into the diversity of tomato-associated members of the genus, and further clarify taxonomic status of the strains using genotypic and phenotypic features. Results of phylogenetic analyses revealed the existence of nine hypothetical new species among the investigated strains. None of the three new subspecies (i.e. C. michiganensis subsp. californiensis, C. michiganensis subsp. chilensis and C. michiganensis subsp. phaseoli) is included within the tomato-pathogenic C. michiganensis sensu stricto lineage. Although comparative genomics revealed the lack of chp and tomA pathogenicity determinant gene clusters in the non-pathogenic strains, a number of pathogenicity related genes were noted to be present in all the strains regardless of their pathogenicity characteristics. Altogether, our results advocate a need for a formal taxonomic reconsideration of tomato-associated Clavibacter spp. strains to facilitate differentiation of the lineages in quarantine inspections.
-
Comparative genomics to develop a specific multiplex PCR assay for detection of Clavibacter michiganensis
Phytopathology, 2019Co-Authors: Shree P. Thapa, Marie-agnès Jacques, Michael O'leary, Robert Gilbertson, Gitta CoakerAbstract:Clavibacter michiganensis (Cm) is a Gram-positive bacterial pathogen that proliferates in the xylem vessels of tomato, causing bacterial wilt and canker symptoms. Accurate detection is a crucial step in confirming outbreaks of bacterial canker and developing management strategies. A major problem with existing detection methods are false positive and negative results. Here, we report the use of comparative genomics of 37 diverse Clavibacter strains, including 21 strains sequenced in this study, to identify specific sequences that are Cm detection targets. Genome-wide phylogenic analyses revealed additional diversity within the genus Clavibacter. Pathogenic Cm strains varied in plasmid composition, highlighting the need for detection methods based on chromosomal targets. We utilized sequences of Cm specific loci two develop a multiplex PCR based diagnostic platform using two Cm chromosomal genes (rhuM and tomA) and an internal control amplifying both bacterial and plant DNA (16s rRNA). The multiplex PCR assay specifically detected Cm strains from a panel of 110 additional bacteria, including other Clavibacter species and bacterial pathogens of tomato. The assay was adapted to detect the presence of Cm in seeds and tomato plant materials with high sensitivity and specificity. In conclusion, the described method represents a robust, specific tool for detection of Cm in tomato seeds and infected plants.
-
Draft Genome Sequences of the Type Strains of Three Clavibacter Subspecies and Atypical Peach-Colored Strains Isolated from Tomato.
Microbiology resource announcements, 2018Co-Authors: Ebrahim Osdaghi, Perrine Portier, Martial Briand, Géraldine Taghouti, Marie-agnès JacquesAbstract:ABSTRACT Here, we present the draft genome sequences of 10 Clavibacter sp. strains, including the type strains of different subspecies of Clavibacter michiganensis and a potentially novel species within the genus. Genome lengths of the strains varied between 2,982,864 and 3,288,331 bp, with G+C contents of 72.23 to 73.50%.
Paul De Vos - One of the best experts on this subject based on the ideXlab platform.
-
Comparative genome analysis of pathogenic and non-pathogenic Clavibacter strains reveals adaptations to their lifestyle
BMC genomics, 2014Co-Authors: Joanna Zaluga, Pieter Stragier, Steve Baeyen, Annelies Haegeman, Johan Van Vaerenbergh, Martine Maes, Paul De VosAbstract:The genus Clavibacter harbors economically important plant pathogens infecting agricultural crops such as potato and tomato. Although the vast majority of Clavibacter strains are pathogenic, there is an increasing number of non-pathogenic isolates reported. Non-pathogenic Clavibacter strains isolated from tomato seeds are particularly problematic because they affect the current detection and identification tests for Clavibacter michiganensis subsp. michiganensis (Cmm), which is regulated with a zero tolerance in tomato seed. Their misidentification as pathogenic Cmm hampers a clear judgment on the seed quality and health. To get more insight in the genetic features linked to the lifestyle of these bacteria, a whole-genome sequence of the tomato seed-borne non-pathogenic Clavibacter LMG 26808 was determined. To gain a better understanding of the molecular determinants of pathogenicity, the genome sequence of LMG 26808 was compared with that of the pathogenic Cmm strain (NCPPB 382). The comparative analysis revealed that LMG 26808 does not contain plasmids pCM1 and pCM2 and also lacks the majority of important virulence factors described so far for pathogenic Cmm. This explains its apparent non-pathogenic nature in tomato plants. Moreover, the genome analysis of LMG 26808 detected sequences from a plasmid originating from a member of Enterobacteriaceae/Klebsiella relative. Genes received that way and coding for antibiotic resistance may provide a competitive advantage for survival of LMG 26808 in its ecological niche. Genetically, LMG 26808 was the most similar to the pathogenic Cmm NCPPB 382 but contained more mobile genetic elements. The genome of this non-pathogenic Clavibacter strain contained also a high number of transporters and regulatory genes. The genome sequence of the non-pathogenic Clavibacter strain LMG 26808 and the comparative analyses with other pathogenic Clavibacter strains provided a better understanding of the genetic bases of virulence and adaptation mechanisms present in the genus Clavibacter.
-
Genetic diversity of non-pathogenic Clavibacter strains isolated from tomato seeds.
Systematic and applied microbiology, 2013Co-Authors: Joanna Zaluga, Pieter Stragier, Johan Van Vaerenbergh, Martine Maes, Paul De VosAbstract:Clavibacter michiganensis subsp. michiganensis (Cmm) is a seed-transmitted, quarantine pathogen which causes bacterial wilt and canker of tomato. Despite efforts to prevent seed contamination, new introductions are regularly detected, associated with new regions of tomato seed production. It seems as if the expanding diversity of Cmm also challenges the limited host range. Clavibacter-like isolates from tomato seed are phenotypically similar to Cmm in the common diagnostic semi-selective media and are identified as Cmm in the customary tests but are not pathogenic to tomato. In our first study four representatives formed a separate cluster in gyrB sequence analysis and in MALDI-TOF MS. Their presence on seed prevents clear judgment on the health status of tomato seeds. As their nature and function are unclear we aimed to investigate and compare them to Cmm. Twenty strains described as Clavibacter-like isolated from tomato seed and not pathogenic to tomato plantlets were selected. Leaf spots, wilting or cankers were not induced after local or systemic inoculation. Tomato stems were not colonized nor was there evidence of survival in tomato stems. Total DNA-DNA hybridization and sequence analysis of gyrB and dnaA proved that they belong to the Cm species but can be unambiguously separated from Cmm. Some of the genes encoding virulence determinants in Cmm strains were also detected in some of the non-pathogenic isolates. Moreover, Cmm strains formed a coherent group, while non-pathogenic Cm strains were heterogenic. The latter was confirmed by BOX-PCR. We speculate that tomato seeds likely represent a larger reservoir of unexplored Clavibacter diversity.
-
multilocus variable number tandem repeats analysis mlva distinguishes a clonal complex of Clavibacter michiganensis subsp michiganensis strains isolated from recent outbreaks of bacterial wilt and canker in belgium
BMC Microbiology, 2013Co-Authors: Joanna Zaluga, Pieter Stragier, Johan Van Vaerenbergh, Martine Maes, Paul De VosAbstract:Clavibacter michiganensis subsp. michiganensis (Cmm) causes bacterial wilt and canker in tomato. Cmm is present nearly in all European countries. During the last three years several local outbreaks were detected in Belgium. The lack of a convenient high-resolution strain-typing method has hampered the study of the routes of transmission of Cmm and epidemiology in tomato cultivation. In this study the genetic relatedness among a worldwide collection of Cmm strains and their relatives was approached by gyrB and dnaA gene sequencing. Further, we developed and applied a multilocus variable number of tandem repeats analysis (MLVA) scheme to discriminate among Cmm strains. A phylogenetic analysis of gyrB and dnaA gene sequences of 56 Cmm strains demonstrated that Belgian Cmm strains from recent outbreaks of 2010–2012 form a genetically uniform group within the Cmm clade, and Cmm is phylogenetically distinct from other Clavibacter subspecies and from non-pathogenic Clavibacter-like strains. MLVA conducted with eight minisatellite loci detected 25 haplotypes within Cmm. All strains from Belgian outbreaks, isolated between 2010 and 2012, together with two French strains from 2010 seem to form one monomorphic group. Regardless of the isolation year, location or tomato cultivar, Belgian strains from recent outbreaks belonged to the same haplotype. On the contrary, strains from diverse geographical locations or isolated over longer periods of time formed mostly singletons. We hypothesise that the introduction might have originated from one lot of seeds or contaminated tomato seedlings that was the source of the outbreak in 2010 and that these Cmm strains persisted and induced infection in 2011 and 2012. Our results demonstrate that MLVA is a promising typing technique for a local surveillance and outbreaks investigation in epidemiological studies of Cmm.
-
GyrB sequence analysis and MALDI-TOF MS as identification tools for plant pathogenic Clavibacter.
Systematic and applied microbiology, 2011Co-Authors: Joanna Zaluga, Johan Van Vaerenbergh, Martine Maes, Kim Heylen, Koenraad Van Hoorde, Bart Hoste, Paul De VosAbstract:The bacterial genus Clavibacter has only one species, Clavibacter michiganensis, containing five subspecies. All five are plant pathogens, among which three are recognized as quarantine pests (mentioned on the EPPO A2 list). Prevention of their introduction and epidemic outbreaks requires a reliable and accurate identification. Currently, identification of these bacteria is time consuming and often problematic, mainly because of cross-reactions with other plant-associated bacteria in immunological tests and false-negative results in PCR detection methods. Furthermore, distinguishing closely related subspecies is not straightforward. This study aimed at evaluating the use of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and a fragment of the gyrB sequence for the reliable and fast identification of the Clavibacter subspecies. Amplification and sequencing of gyrB using a single primer set had sufficient resolution and specificity to identify each subspecies based on both sequence similarities in cluster analyses and specific signatures within the sequences. All five subspecies also generated distinct and reproducible MALDI-TOF MS profiles, with unique and specific ion peaks for each subspecies, which could be used as biomarkers for identification. Results from both methods were in agreement and were able to distinguish the five Clavibacter subspecies from each other and from representatives of closely related Rathayibacter, Leifsonia or Curtobacterium species. Our study suggests that proteomic analysis using MALDI-TOF MS and gyrB sequence are powerful diagnostic tools for the accurate identification of Clavibacter plant pathogens.
Rudolf Eichenlaub - One of the best experts on this subject based on the ideXlab platform.
-
The Clavibacter michiganensis Subspecies: Molecular Investigation of Gram-Positive Bacterial Plant Pathogens
Annual review of phytopathology, 2011Co-Authors: Rudolf Eichenlaub, Karl-heinz GartemannAbstract:Clavibacter michiganensis subspecies are actinomycete plant pathogens residing mainly in the xylem vessels that infect economically important host plants. In the Clavibacter subspecies michiganensis and sepedonicus, infecting tomato and potato, respectively, essential factors for disease induction are plasmid encoded and loss of the virulence plasmids converts these biotrophic pathogens into endophytes. The genes responsible for successful colonization of the host plant, including evasion/suppression of plant defense reactions, are chromosomally encoded. Several serine proteases seem to be involved in colonization. They are secreted by Clavibacter, but their targets remain unknown. A type 3 secretion system (T3SS) translocating effectors into the plant cells is absent in these gram-positive pathogens. With the development of the modern ‘omics technologies for RNA and proteins based on the known genome sequences, a new phase in the investigation of the mechanisms of plant pathogenicity has begun to allow the genome-wide investigation of the Clavibacter-host interaction.
-
The endolysins of bacteriophages CMP1 and CN77 are specific for the lysis of Clavibacter michiganensis strains.
Microbiology, 2010Co-Authors: Johannes Wittmann, Rudolf Eichenlaub, Brigitte DreiseikelmannAbstract:Putative endolysin genes of bacteriophages CMP1 and CN77, which infect Clavibacter michiganensis subsp. michiganensis and C. michiganensis subsp. nebraskensis, respectively, were cloned and expressed in Escherichia coli. The His-tagged endolysin of CMP1 consists of 306 amino acids and has a calculated molecular mass of 34.8 kDa, while the His-tagged endolysin of CN77 has 290 amino acids with a molecular mass of 31.9 kDa. The proteins were purified and their bacteriolytic activity was demonstrated. The bacteriolytic activity of both enzymes showed a host range which was limited to the respective C. michiganensis subspecies and did not affect other bacteria, even those closely related to Clavibacter. Due to the high specificity of the CMP1 and CN77 endolysins they may be useful tools for biocontrol of plant-pathogenic C. michiganensis without affecting other bacteria in the soil.
-
Transformation of the phytopathogenic bacterium Clavibacter michiganense subsp. michiganense by electroporation and development of a cloning vector
Journal of Bacteriology, 1991Co-Authors: Dietmar Meletzus, Rudolf EichenlaubAbstract:We constructed a cloning vector for use in the plant pathogenic bacterium Clavibacter michiganense subsp. michiganense. The vector pDM100 consists of a 3.2-kb restriction fragment of the Clavibacter plasmid pCM1 joined to a pBR325 derivative carrying the neomycin phosphotransferase of transposon Tn5 and the gentamicin acetyltransferase of Tn1696. Both antibiotic resistance genes are efficiently expressed in C. michiganense subsp. michiganense. Although polyethylene glycol-mediated transfection of spheroplasts with the DNA of the C. michiganense subsp. michiganense-specific bacteriophage CMP1 yielded about 3 x 10(3) transfectants per microgram of DNA, in transformations with plasmid DNA only a very few transformants were obtained. However, the transformation efficiency could be improved by electroporation of intact cells, giving about 2 x 10(3) transformants per microgram of plasmid DNA. Since a transformation procedure and a cloning vector are now available, pathogenicity in C. michiganense subsp. michiganense can now be analyzed genetically.
-
Genetic and Physiological Aspects of the Pathogenic Interaction of Clavibacter Michiganense subsp. Michiganense with the Host Plant
Advances in Molecular Genetics of Plant-Microbe Interactions Vol. 1, 1991Co-Authors: Rudolf Eichenlaub, Andreas Bermpohl, Dietmar MeletzusAbstract:The tomatopathogen Clavibacter michiganense subsp. michiganense NCPPB382 can be shown to produce a wilt inducing exopolysaccharide (EPS). The EPS has been purified. It consists of fucose (38.8%), galactose (30.1%), and glucose (31.1%). A plasmid curing was performed to determine whether the two plasmids (pCM1 and pCM2) carried by the strain were involved in pathogenicity. Derivatives of NCPPB382 lacking both plasmids were found to be apathogenic, exhibiting only a slight reduction of the biomass. However, they are able to effectively colonize the plant and can produce the toxic EPS in culture. Therefore, it appears possible that EPS production in planta is repressed under certain conditions. Our observations suggest that the plasmids may carry determinants responsible for the development of the disease. In order to be able to identify these gene loci a transformation procedure and a cloning vector for Clavibacter have been developed. This system has been successfully employed to clone the plasmid pCM 1 encoded endocellulase.
Yongbao Pan - One of the best experts on this subject based on the ideXlab platform.
-
a polymerase chain reaction protocol for the detection of Clavibacter xyli subsp xyli the causal bacterium of sugarcane ratoon stunting disease
Plant Disease, 1998Co-Authors: Yongbao Pan, M P Grisham, D M Burner, K E Damann, Q WeiAbstract:A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.