The Experts below are selected from a list of 672 Experts worldwide ranked by ideXlab platform
Didier Debroas - One of the best experts on this subject based on the ideXlab platform.
-
Diversity, spatial distribution and activity of fungi in freshwater ecosystems.
PeerJ, 2019Co-Authors: Cecile Lepere, Isabelle Domaizon, Mylene Hugoni, Jean-françois Humbert, Ludwig Jardillier, Didier DebroasAbstract:High-throughput sequencing has given new insights into aquatic fungal community ecology over the last 10 years. Based on 18S ribosomal RNA gene sequences publicly available, we investigated fungal richness and taxonomic composition among 25 lakes and four rivers. We used a single pipeline to process the reads from raw data to the taxonomic affiliation. In addition, we studied, for a subset of lakes, the active fraction of fungi through the 18S rRNA transcripts level. These results revealed a high diversity of fungi that can be captured by 18S rRNA primers. The most OTU-rich groups were Dikarya (47%), represented by putative filamentous fungi more diverse and abundant in freshwater habitats than previous studies have suggested, followed by Cryptomycota (17.6%) and Chytridiomycota (15.4%). The active fraction of the community showed the same dominant groups as those observed at the 18S rRNA genes level. On average 13.25% of the fungal OTUs were active. The small number of OTUs shared among aquatic ecosystems may result from the low abundances of those microorganisms and/or they constitute allochthonous fungi coming from other habitats (e.g., sediment or catchment areas). The richness estimates suggest that fungi have been overlooked and undersampled in freshwater ecosystems, especially rivers, though they play key roles in ecosystem functioning as saprophytes and parasites.
-
diversity and dynamics of active small microbial eukaryotes in the anoxic zone of a freshwater meromictic lake pavin france
Frontiers in Microbiology, 2016Co-Authors: Didier Debroas, Cecile Lepere, Isabelle Domaizon, Mylene Hugoni, Agnes VelletAbstract:Microbial eukaryotes play a crucial role in ecosystem functioning and oxygen is considered to be one of the strongest barriers against their local dispersal. However, diversity of microbial eukaryotes in freshwater habitats with oxygen gradients has previously received very little attention. We applied high-throughput sequencing (V4 region of the 18S rRNA gene) in conjunction with quantitative PCR (DNA and RNA) and fluorescent in situ hybridization analyses, to provide an unique spatio-temporal analysis of microbial eukaryotes diversity and potential activity in a meromictic freshwater lake (lake Pavin). This study revealed a high genetic diversity of unicellular eukaryotes in the permanent anoxic zone of lake Pavin and allowed the discrimination of active vs. inactive components. 42 % of the OTUs (Operational taxonomic Units) are exclusively present in the monimolimnion, where Alveolata (Ciliophora and Dinophyceae) and Fungi (Dikarya and Chytrids) are the most active phyla and are probably represented by species capable of anaerobic metabolism. Pigmented eukaryotes (Haptophyceae and Chlorophyceae) are also present and active in this zone, which opens up questions regarding their metabolism.
-
seqAll_mixEUK
2016Co-Authors: Eric Capo, Didier Debroas, Fabien Arnaud, Typhaine Guillemot, Vincent Bichet, Laurent Millet, Emilie Gauthier, Charly Massa, Anne-lise Develle, Cecile PignolAbstract:Demultiplexing file from MiSEQ sequencing (2 x 250 bp) of a Mock community (16 species) amplifiying with the following primers: 960F: GGCTTAATTTGACTCAACRCG 1419R: GGGCATCACAGACCTGTTAT For obtaining this file, the paired-end reads were merged together using UPARSE tools (option -fastq_mergepairs with a minimal overlap equal to 150 and no mismatch allowed) (Edgar, 2013). and the merged sequences were then submitted to the following cleaning procedures: (i) no undefined bases (Ns), (ii) a minimum sequence length of 200 bp, and (iii) no sequencing error in the forward and reverse primers. Composition of the mock community: A50 Eukaryota;Rhizaria;Cercozoa; A31 Eukaryota;Alveolata;Perkinsea; A54 Eukaryota;Cryptophyceae A34 Eukaryota;Stramenopiles;Chrysophyceae; A44 Eukaryota;Fungi; PG5-14 Eukaryota;Archaeplastida;Chloroplastida;Chlorophyta;Chlorophyceae PG5-26 Eukaryota;Alveolata;Ciliophora; PG5-28 Eukaryota;Fungi;Cryptomycota; BI109 Eukaryota;Fungi;Cryptomycota; (LKM11 clade) B24 Eukaryota;Stramenopiles;Bicosoecida; B64 Eukaryota;Fungi;Chytridiomycota; B79 Eukaryota;Fungi;Dikarya; B26 Eukaryota;Alveolata;Perkinsozoa BA97 Eukaryota;Cryptophyta; B36 Eukaryota;Stramenopiles;Ochrophyta;Chrysophyceae; BA231 Eukaryota;Alveolata;Ciliophora;Alveolate_1
-
Diversity and Dynamics of Active Small Microbial Eukaryotes in the Anoxic Zone of a Freshwater Meromictic Lake (Pavin, France)
Frontiers in Microbiology, 2016Co-Authors: Cecile Lepere, Isabelle Domaizon, Mylene Hugoni, Agnes Vellet, Didier DebroasAbstract:Microbial eukaryotes play a crucial role in ecosystem functioning and oxygen is considered to be one of the strongest barriers against their local dispersal. However, diversity of microbial eukaryotes in freshwater habitats with oxygen gradients has previously received very little attention. We applied high-throughput sequencing (V4 region of the 18S rRNA gene) in conjunction with quantitative PCR (DNA and RNA) and fluorescent in situ hybridization (FISH) analyses, to provide an unique spatio-temporal analysis of microbial eukaryotes diversity and potential activity in a meromictic freshwater lake (lake Pavin). This study revealed a high genetic diversity of unicellular eukaryotes in the permanent anoxic zone of lake Pavin and allowed the discrimination of active vs. inactive components. Forty-two percent of the OTUs (Operational Taxonomic Units) are exclusively present in the monimolimnion, where Alveolata (Ciliophora and Dinophyceae) and Fungi (Dikarya and Chytrids) are the most active phyla and are probably represented by species capable of anaerobic metabolism. Pigmented eukaryotes (Haptophyceae and Chlorophyceae) are also present and active in this zone, which opens up questions regarding their metabolism.
-
Short‐term dynamics of diversity patterns: evidence of continual reassembly within lacustrine small eukaryotes
Environmental microbiology, 2013Co-Authors: Jean-françois Mangot, Isabelle Domaizon, Najwa Taib, Nemr Marouni, Emilie Duffaud, Gisèle Bronner, Didier DebroasAbstract:The short-term variation in the community structure of freshwater small eukaryotes (0.2-5 μm) was investigated in a mesotrophic lake every 2-3 days over one summer by coupling three molecular methods: 454 amplicon pyrosequencing, qPCR and TSA-FISH. The pyrosequencing approach unveiled a much more extensive small-eukaryotic diversity (991 OTUs) than has been described previously. The vast majority of the diversity described was represented by rare OTUs (≤ 0.01% of reads) belonging primarily to Cryptomycota, Dikarya and photosynthetic organisms, which were never detected as abundant in any of the samples. The small eukaryote community was characterized by a continual and important reassembly. These rearrangements involved the 20 'core taxa' (≥ 1% of reads), and, were essentially due to a handful of OTUs that were detected in intermediate abundance (0.01-1% of reads) and sporadically in dominant taxa. Putative bacterivorous (Ciliophora and Cercozoa) as well as parasitic and saprotrophic taxa (Perkinsozoa and Cryptomycota) were involved in these changes of diversity. A putative infection of microalgae by a lacustrine perkinsozoan was also reported for the first time in this study. Open questions regarding both the patterns that govern the rapid small eukaryote reassemblies and the possible biogeography of these organisms arise from this study.
Alexander Idnurm - One of the best experts on this subject based on the ideXlab platform.
-
The Fungal Kingdom - Fungal Sex: The Mucoromycota.
Microbiology spectrum, 2017Co-Authors: Soo Chan Lee, Alexander IdnurmAbstract:Although at the level of resolution of genes and molecules most information about mating in fungi is from a single lineage, the Dikarya, many fundamental discoveries about mating in fungi have been made in the earlier branches of the fungi. These are nonmonophyletic groups that were once classified into the chytrids and zygomycetes. Few species in these lineages offer the potential of genetic tractability, thereby hampering the ability to identify the genes that underlie those fundamental insights. Research performed during the past decade has now established the genes required for mating type determination and pheromone synthesis in some species in the phylum Mucoromycota, especially in the order Mucorales. These findings provide striking parallels with the evolution of mating systems in the Dikarya fungi. Other discoveries in the Mucorales provide the first examples of sex-cell type identity being driven directly by a gene that confers mating type, a trait considered more of relevance to animal sex determination but difficult to investigate in animals. Despite these discoveries, there remains much to be gleaned about mating systems from these fungi.
-
Phytochelatin synthase is required for tolerating metal toxicity in a basidiomycete yeast and is a conserved factor involved in metal homeostasis in fungi
Fungal Biology and Biotechnology, 2015Co-Authors: Alaina M Shine, Viplendra Ps Shakya, Alexander IdnurmAbstract:Background Phytochelatin synthase (PCS) is an enzyme that catalyzes the biosynthesis of phytochelatin from glutathione. Phytochelatins protect cells against the toxic effects of non-essential heavy metals, such as cadmium, and hence growth is restricted in the presence of these metals in mutants in PCS-encoding genes. PCS genes from fungi have been characterized in only two species in the Ascomycota, and these genes are considered sparsely distributed in the fungal kingdom. Results A gene encoding a putative PCS was identified in Sporobolomyces sp. strain IAM 13481, a fungus that is a member of the Pucciniomycotina subphylum of the Basidiomycota. The function of this PCS1 gene was assessed by heterologous expression in the Ascomycota yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe , and by mutating the gene in Sporobolomyces . The gene is required for tolerance to toxic concentrations of non-essential cadmium as well as the essential metal copper. Pcs1 homologs in fungi and other eukaryotes have putative targeting sequences for mitochondrial localization: the S. pombe homolog was fused to green fluorescent protein and it co-localized with a mitochondrial dye. Evaluation of the presence or absence of PCS and PCS-like homologs in the genome sequences of fungi indicates that they have a wide distribution, and the absence in most Ascomycota and Basidiomycota (the Dikarya) species can be explained by a small number of gene losses. Conclusions The ecology of the species within the fungi carrying putative PCS genes, the phenotypes of phytochelatin synthase mutants in two major fungal lineages, and the presence of homologs in many non-Dikarya lineages parallel what is seen in the plant and animal kingdoms. That is, PCS is a protein present early during the evolution of the fungi and whose role is not solely dedicated to combating toxic concentrations of non-essential metals.
-
Phytochelatin synthase is required for tolerating metal toxicity in a basidiomycete yeast and is a conserved factor involved in metal homeostasis in fungi
Fungal Biology and Biotechnology, 2015Co-Authors: Alaina M Shine, Viplendra Ps Shakya, Alexander IdnurmAbstract:Background Phytochelatin synthase (PCS) is an enzyme that catalyzes the biosynthesis of phytochelatin from glutathione. Phytochelatins protect cells against the toxic effects of non-essential heavy metals, such as cadmium, and hence growth is restricted in the presence of these metals in mutants in PCS-encoding genes. PCS genes from fungi have been characterized in only two species in the Ascomycota, and these genes are considered sparsely distributed in the fungal kingdom. Results A gene encoding a putative PCS was identified in Sporobolomyces sp. strain IAM 13481, a fungus that is a member of the Pucciniomycotina subphylum of the Basidiomycota. The function of this PCS1 gene was assessed by heterologous expression in the Ascomycota yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe , and by mutating the gene in Sporobolomyces . The gene is required for tolerance to toxic concentrations of non-essential cadmium as well as the essential metal copper. Pcs1 homologs in fungi and other eukaryotes have putative targeting sequences for mitochondrial localization: the S. pombe homolog was fused to green fluorescent protein and it co-localized with a mitochondrial dye. Evaluation of the presence or absence of PCS and PCS-like homologs in the genome sequences of fungi indicates that they have a wide distribution, and the absence in most Ascomycota and Basidiomycota (the Dikarya) species can be explained by a small number of gene losses. Conclusions The ecology of the species within the fungi carrying putative PCS genes, the phenotypes of phytochelatin synthase mutants in two major fungal lineages, and the presence of homologs in many non-Dikarya lineages parallel what is seen in the plant and animal kingdoms. That is, PCS is a protein present early during the evolution of the fungi and whose role is not solely dedicated to combating toxic concentrations of non-essential metals.
-
Sexual Pheromones in the Fungi
Biocommunication of Fungi, 2012Co-Authors: Silvia Polaino, Alexander IdnurmAbstract:The capability of sexual reproduction is distributed across the eukaryotes, including the fungi. A primary influence in the sexual interaction is the exchange of information mediated by diffusible molecules, called sexual pheromones. This chapter examines the biosynthesis of pheromones and the sexual responses induced by them in different branches of the fungal kingdom, with an emphasis on the early lineages. The best-studied species are members of the Dikarya and they use pheromones derived from peptide precursors. In contrast, members of the Mucoromycotina use apocarotenoids while the Blastocladiomycota use sesquiterpenes. Comparison between these pheromones establishes evolutionary trends among the fungal lineages.
-
Two Origins for the Gene Encoding α-Isopropylmalate Synthase in Fungi
PloS one, 2010Co-Authors: Erica M. Larson, Alexander IdnurmAbstract:Background: The biosynthesis of leucine is a biochemical pathway common to prokaryotes, plants and fungi, but absent from humans and animals. The pathway is a proposed target for antimicrobial therapy. Methodology/Principal Findings: Here we identified the leuA gene encoding a-isopropylmalate synthase in the zygomycete fungus Phycomyces blakesleeanus using a genetic mapping approach with crosses between wild type and leucine auxotrophic strains. To confirm the function of the gene, Phycomyces leuA was used to complement the auxotrophic phenotype exhibited by mutation of the leu3 + gene of the ascomycete fungus Schizosaccharomyces pombe. Phylogenetic analysis revealed that the leuA gene in Phycomyces, other zygomycetes, and the chytrids is more closely related to homologs in plants and photosynthetic bacteria than ascomycetes or basidiomycetes, and suggests that the Dikarya have acquired the gene more recently. Conclusions/Significance: The identification of leuA in Phycomyces adds to the growing body of evidence that some primary metabolic pathways or parts of them have arisen multiple times during the evolution of fungi, probably through horizontal gene transfer events.
Joseph W. Spatafora - One of the best experts on this subject based on the ideXlab platform.
-
Phylogenomic Analyses of Non-Dikarya Fungi Supports Horizontal Gene Transfer Driving Diversification of Secondary Metabolism in the Amphibian Gastrointestinal Symbiont, Basidiobolus.
G3 (Bethesda Md.), 2020Co-Authors: Javier F. Tabima, Igor V. Grigoriev, Ian A. Trautman, Ying Chang, Yan Wang, Stephen J Mondo, Alan Kuo, Asaf Salamov, Jason E. Stajich, Joseph W. SpataforaAbstract:Author(s): Tabima, Javier F; Trautman, Ian A; Chang, Ying; Wang, Yan; Mondo, Stephen; Kuo, Alan; Salamov, Asaf; Grigoriev, Igor V; Stajich, Jason E; Spatafora, Joseph W | Abstract: Research into secondary metabolism (SM) production by fungi has resulted in the discovery of diverse, biologically active compounds with significant medicinal applications. The fungi rich in SM production are taxonomically concentrated in the subkingdom Dikarya, which comprises the phyla Ascomycota and Basidiomycota. Here, we explore the potential for SM production in Mucoromycota and Zoopagomycota, two phyla of nonflagellated fungi that are not members of Dikarya, by predicting and identifying core genes and gene clusters involved in SM. The majority of non-Dikarya have few genes and gene clusters involved in SM production except for the amphibian gut symbionts in the genus Basidiobolus Basidiobolus genomes exhibit an enrichment of SM genes involved in siderophore, surfactin-like, and terpene cyclase production, all these with evidence of constitutive gene expression. Gene expression and chemical assays also confirm that Basidiobolus has significant siderophore activity. The expansion of SMs in Basidiobolus are partially due to horizontal gene transfer from bacteria, likely as a consequence of its ecology as an amphibian gut endosymbiont.
-
phylogenetic taxon definitions for fungi Dikarya ascomycota and basidiomycota
IMA fungus, 2018Co-Authors: David S Hibbett, Joseph W. Spatafora, Meredith Blackwell, Timothy Y. James, John W. Taylor, Rytas VilgalysAbstract:Phylogenetic taxon definitions (PTDs) are explicit, phylogeny-based statements that specify clades. PTDs are central to the system of rank-free classification that is governed by the PhyloCode, but they can also be used to clarify the meanings of ranked names. We present PTDs for four major groups: Fungi, Dikarya, Ascomycota, and Basidiomycota.
-
The Fungal Kingdom - The Fungal Tree of Life: from Molecular Systematics to Genome-Scale Phylogenies.
Microbiology spectrum, 2017Co-Authors: Joseph W. Spatafora, Igor V. Grigoriev, M. Catherine Aime, Francis Martin, Jason E. Stajich, Meredith BlackwellAbstract:The kingdom Fungi is one of the more diverse clades of eukaryotes in terrestrial ecosystems, where they provide numerous ecological services ranging from decomposition of organic matter and nutrient cycling to beneficial and antagonistic associations with plants and animals. The evolutionary relationships of the kingdom have represented some of the more recalcitrant problems in systematics and phylogenetics. The advent of molecular phylogenetics, and more recently phylogenomics, has greatly advanced our understanding of the patterns and processes associated with fungal evolution, however. In this article, we review the major phyla, subphyla, and classes of the kingdom Fungi and provide brief summaries of ecologies, morphologies, and exemplar taxa. We also provide examples of how molecular phylogenetics and evolutionary genomics have advanced our understanding of fungal evolution within each of the phyla and some of the major classes. In the current classification we recognize 8 phyla, 12 subphyla, and 46 classes within the kingdom. The ancestor of fungi is inferred to be zoosporic, and zoosporic fungi comprise three lineages that are paraphyletic to the remainder of fungi. Fungi historically classified as zygomycetes do not form a monophyletic group and are paraphyletic to Ascomycota and Basidiomycota. Ascomycota and Basidiomycota are each monophyletic and collectively form the subkingdom Dikarya.
-
the fungal tree of life from molecular systematics to genome scale phylogenies
Microbiology spectrum, 2017Co-Authors: Joseph W. Spatafora, Igor V. Grigoriev, Francis Martin, Jason E. Stajich, Catherine M Aime, Meredith BlackwellAbstract:The kingdom Fungi is one of the more diverse clades of eukaryotes in terrestrial ecosystems, where they provide numerous ecological services ranging from decomposition of organic matter and nutrient cycling to beneficial and antagonistic associations with plants and animals. The evolutionary relationships of the kingdom have represented some of the more recalcitrant problems in systematics and phylogenetics. The advent of molecular phylogenetics, and more recently phylogenomics, has greatly advanced our understanding of the patterns and processes associated with fungal evolution, however. In this article, we review the major phyla, subphyla, and classes of the kingdom Fungi and provide brief summaries of ecologies, morphologies, and exemplar taxa. We also provide examples of how molecular phylogenetics and evolutionary genomics have advanced our understanding of fungal evolution within each of the phyla and some of the major classes. In the current classification we recognize 8 phyla, 12 subphyla, and 46 classes within the kingdom. The ancestor of fungi is inferred to be zoosporic, and zoosporic fungi comprise three lineages that are paraphyletic to the remainder of fungi. Fungi historically classified as zygomycetes do not form a monophyletic group and are paraphyletic to Ascomycota and Basidiomycota. Ascomycota and Basidiomycota are each monophyletic and collectively form the subkingdom Dikarya.
-
A phylum-level phylogenetic classification of zygomycete fungi based on genome-scale data
Mycologia, 2016Co-Authors: Joseph W. Spatafora, Igor V. Grigoriev, Ying Chang, Mary L. Berbee, Matthew E. Smith, Gerald L. Benny, Katy Lazarus, Gregory Bonito, Nicolas Corradi, Andrii P. GryganskyiAbstract:Zygomycete fungi were classified as a single phylum, Zygomycota, based on sexual reproduction by zygospores, frequent asexual reproduction by sporangia, absence of multicellular sporocarps, and production of coenocytic hyphae, all with some exceptions. Molecular phylogenies based on one or a few genes did not support the monophyly of the phylum, however, and the phylum was subsequently abandoned. Here we present phylogenetic analyses of a genome-scale data set for 46 taxa, including 25 zygomycetes and 192 proteins, and we demonstrate that zygomycetes comprise two major clades that form a paraphyletic grade. A formal phylogenetic classification is proposed herein and includes two phyla, six subphyla, four classes and 16 orders. On the basis of these results, the phyla Mucoromycota and Zoopagomycota are circumscribed. Zoopagomycota comprises Entomophtoromycotina, Kickxellomycotina and Zoopagomycotina; it constitutes the earliest diverging lineage of zygomycetes and contains species that are primarily parasites and pathogens of small animals (e.g. amoeba, insects, etc.) and other fungi, i.e. mycoparasites. Mucoromycota comprises Glomeromycotina, Mortierellomycotina, and Mucoromycotina and is sister to Dikarya. It is the more derived clade of zygomycetes and mainly consists of mycorrhizal fungi, root endophytes, and decomposers of plant material. Evolution of trophic modes, morphology, and analysis of genome-scale data are discussed.
Isabelle Domaizon - One of the best experts on this subject based on the ideXlab platform.
-
Diversity, spatial distribution and activity of fungi in freshwater ecosystems.
PeerJ, 2019Co-Authors: Cecile Lepere, Isabelle Domaizon, Mylene Hugoni, Jean-françois Humbert, Ludwig Jardillier, Didier DebroasAbstract:High-throughput sequencing has given new insights into aquatic fungal community ecology over the last 10 years. Based on 18S ribosomal RNA gene sequences publicly available, we investigated fungal richness and taxonomic composition among 25 lakes and four rivers. We used a single pipeline to process the reads from raw data to the taxonomic affiliation. In addition, we studied, for a subset of lakes, the active fraction of fungi through the 18S rRNA transcripts level. These results revealed a high diversity of fungi that can be captured by 18S rRNA primers. The most OTU-rich groups were Dikarya (47%), represented by putative filamentous fungi more diverse and abundant in freshwater habitats than previous studies have suggested, followed by Cryptomycota (17.6%) and Chytridiomycota (15.4%). The active fraction of the community showed the same dominant groups as those observed at the 18S rRNA genes level. On average 13.25% of the fungal OTUs were active. The small number of OTUs shared among aquatic ecosystems may result from the low abundances of those microorganisms and/or they constitute allochthonous fungi coming from other habitats (e.g., sediment or catchment areas). The richness estimates suggest that fungi have been overlooked and undersampled in freshwater ecosystems, especially rivers, though they play key roles in ecosystem functioning as saprophytes and parasites.
-
diversity and dynamics of active small microbial eukaryotes in the anoxic zone of a freshwater meromictic lake pavin france
Frontiers in Microbiology, 2016Co-Authors: Didier Debroas, Cecile Lepere, Isabelle Domaizon, Mylene Hugoni, Agnes VelletAbstract:Microbial eukaryotes play a crucial role in ecosystem functioning and oxygen is considered to be one of the strongest barriers against their local dispersal. However, diversity of microbial eukaryotes in freshwater habitats with oxygen gradients has previously received very little attention. We applied high-throughput sequencing (V4 region of the 18S rRNA gene) in conjunction with quantitative PCR (DNA and RNA) and fluorescent in situ hybridization analyses, to provide an unique spatio-temporal analysis of microbial eukaryotes diversity and potential activity in a meromictic freshwater lake (lake Pavin). This study revealed a high genetic diversity of unicellular eukaryotes in the permanent anoxic zone of lake Pavin and allowed the discrimination of active vs. inactive components. 42 % of the OTUs (Operational taxonomic Units) are exclusively present in the monimolimnion, where Alveolata (Ciliophora and Dinophyceae) and Fungi (Dikarya and Chytrids) are the most active phyla and are probably represented by species capable of anaerobic metabolism. Pigmented eukaryotes (Haptophyceae and Chlorophyceae) are also present and active in this zone, which opens up questions regarding their metabolism.
-
Diversity and Dynamics of Active Small Microbial Eukaryotes in the Anoxic Zone of a Freshwater Meromictic Lake (Pavin, France)
Frontiers in Microbiology, 2016Co-Authors: Cecile Lepere, Isabelle Domaizon, Mylene Hugoni, Agnes Vellet, Didier DebroasAbstract:Microbial eukaryotes play a crucial role in ecosystem functioning and oxygen is considered to be one of the strongest barriers against their local dispersal. However, diversity of microbial eukaryotes in freshwater habitats with oxygen gradients has previously received very little attention. We applied high-throughput sequencing (V4 region of the 18S rRNA gene) in conjunction with quantitative PCR (DNA and RNA) and fluorescent in situ hybridization (FISH) analyses, to provide an unique spatio-temporal analysis of microbial eukaryotes diversity and potential activity in a meromictic freshwater lake (lake Pavin). This study revealed a high genetic diversity of unicellular eukaryotes in the permanent anoxic zone of lake Pavin and allowed the discrimination of active vs. inactive components. Forty-two percent of the OTUs (Operational Taxonomic Units) are exclusively present in the monimolimnion, where Alveolata (Ciliophora and Dinophyceae) and Fungi (Dikarya and Chytrids) are the most active phyla and are probably represented by species capable of anaerobic metabolism. Pigmented eukaryotes (Haptophyceae and Chlorophyceae) are also present and active in this zone, which opens up questions regarding their metabolism.
-
Short‐term dynamics of diversity patterns: evidence of continual reassembly within lacustrine small eukaryotes
Environmental microbiology, 2013Co-Authors: Jean-françois Mangot, Isabelle Domaizon, Najwa Taib, Nemr Marouni, Emilie Duffaud, Gisèle Bronner, Didier DebroasAbstract:The short-term variation in the community structure of freshwater small eukaryotes (0.2-5 μm) was investigated in a mesotrophic lake every 2-3 days over one summer by coupling three molecular methods: 454 amplicon pyrosequencing, qPCR and TSA-FISH. The pyrosequencing approach unveiled a much more extensive small-eukaryotic diversity (991 OTUs) than has been described previously. The vast majority of the diversity described was represented by rare OTUs (≤ 0.01% of reads) belonging primarily to Cryptomycota, Dikarya and photosynthetic organisms, which were never detected as abundant in any of the samples. The small eukaryote community was characterized by a continual and important reassembly. These rearrangements involved the 20 'core taxa' (≥ 1% of reads), and, were essentially due to a handful of OTUs that were detected in intermediate abundance (0.01-1% of reads) and sporadically in dominant taxa. Putative bacterivorous (Ciliophora and Cercozoa) as well as parasitic and saprotrophic taxa (Perkinsozoa and Cryptomycota) were involved in these changes of diversity. A putative infection of microalgae by a lacustrine perkinsozoan was also reported for the first time in this study. Open questions regarding both the patterns that govern the rapid small eukaryote reassemblies and the possible biogeography of these organisms arise from this study.
-
Short-term dynamics of diversity patterns: evidence of continual reassembly within lacustrine small eukaryotes.
Environmental Microbiology, 2012Co-Authors: Jean-françois Mangot, Isabelle Domaizon, Najwa Taib, Nemr Marouni, Emilie Duffaud, Gisèle Bronner, Didier DebroasAbstract:The short-term variation in the community structure of freshwater small eukaryotes (0.2-5 μm) was investigated in a mesotrophic lake every 2-3 days over one summer by coupling three molecular methods: 454 amplicon pyrosequencing, qPCR and TSA-FISH. The pyrosequencing approach unveiled a much more extensive small-eukaryotic diversity (991 OTUs) than has been described previously. The vast majority of the diversity described was represented by rare OTUs (≤ 0.01% of reads) belonging primarily to Cryptomycota, Dikarya and photosynthetic organisms, which were never detected as abundant in any of the samples. The small eukaryote community was characterized by a continual and important reassembly. These rearrangements involved the 20 'core taxa' (≥ 1% of reads), and, were essentially due to a handful of OTUs that were detected in intermediate abundance (0.01-1% of reads) and sporadically in dominant taxa. Putative bacterivorous (Ciliophora and Cercozoa) as well as parasitic and saprotrophic taxa (Perkinsozoa and Cryptomycota) were involved in these changes of diversity. A putative infection of microalgae by a lacustrine perkinsozoan was also reported for the first time in this study. Open questions regarding both the patterns that govern the rapid small eukaryote reassemblies and the possible biogeography of these organisms arise from this study.
Igor V. Grigoriev - One of the best experts on this subject based on the ideXlab platform.
-
Phylogenomic Analyses of Non-Dikarya Fungi Supports Horizontal Gene Transfer Driving Diversification of Secondary Metabolism in the Amphibian Gastrointestinal Symbiont, Basidiobolus.
G3 (Bethesda Md.), 2020Co-Authors: Javier F. Tabima, Igor V. Grigoriev, Ian A. Trautman, Ying Chang, Yan Wang, Stephen J Mondo, Alan Kuo, Asaf Salamov, Jason E. Stajich, Joseph W. SpataforaAbstract:Author(s): Tabima, Javier F; Trautman, Ian A; Chang, Ying; Wang, Yan; Mondo, Stephen; Kuo, Alan; Salamov, Asaf; Grigoriev, Igor V; Stajich, Jason E; Spatafora, Joseph W | Abstract: Research into secondary metabolism (SM) production by fungi has resulted in the discovery of diverse, biologically active compounds with significant medicinal applications. The fungi rich in SM production are taxonomically concentrated in the subkingdom Dikarya, which comprises the phyla Ascomycota and Basidiomycota. Here, we explore the potential for SM production in Mucoromycota and Zoopagomycota, two phyla of nonflagellated fungi that are not members of Dikarya, by predicting and identifying core genes and gene clusters involved in SM. The majority of non-Dikarya have few genes and gene clusters involved in SM production except for the amphibian gut symbionts in the genus Basidiobolus Basidiobolus genomes exhibit an enrichment of SM genes involved in siderophore, surfactin-like, and terpene cyclase production, all these with evidence of constitutive gene expression. Gene expression and chemical assays also confirm that Basidiobolus has significant siderophore activity. The expansion of SMs in Basidiobolus are partially due to horizontal gene transfer from bacteria, likely as a consequence of its ecology as an amphibian gut endosymbiont.
-
Broad‐specificity GH131 β‐glucanases are a hallmark of fungi and oomycetes that colonize plants
Environmental Microbiology, 2019Co-Authors: Georgios Anasontzis, Robert Riley, Marc-henri Lebrun, Mireille Haon, Charlotte Champion, Annegret Kohler, Nicolas Lenfant, Francis Martin, Richard J. O’connell, Igor V. GrigorievAbstract:Plant-tissue-colonizing fungi fine-tune the deconstruction of plant-cell walls (PCW) using different sets of enzymes according to their lifestyle. However, some of these enzymes are conserved among fungi with dissimilar lifestyles. We identified genes from Glycoside Hydrolase family GH131 as commonly expressed during plant-tissue colonization by saprobic, pathogenic and symbiotic fungi. By searching all the publicly available genomes, we found that GH131-coding genes were widely distributed in the Dikarya subkingdom, except in Taphrinomycotina and Saccharomycotina, and in phytopathogenic Oomycetes, but neither other eukaryotes nor prokaryotes. The presence of GH131 in a species was correlated with its association with plants as symbiont, pathogen or saprobe. We propose that GH131-family expansions and horizontal-gene transfers contributed to this adaptation. We analysed the biochemical activities of GH131 enzymes whose genes were upregulated during plant-tissue colonization in a saprobe (Pycnoporus sanguineus), a plant symbiont (Laccaria bicolor) and three hemibiotrophic-plant pathogens (Colletotrichum higginsianum, C. graminicola, Zymoseptoria tritici). These enzymes were all active on substrates with β-1,4, β-1,3 and mixed β-1,4/1,3 glucosidic linkages. Combined with a cellobiohydrolase, GH131 enzymes enhanced cellulose degradation. We propose that secreted GH131 enzymes unlock the PCW barrier and allow further deconstruction by other enzymes during plant tissue colonization by symbionts, pathogens and saprobes.
-
Phylogenomics of Endogonaceae and evolution of mycorrhizas within Mucoromycota.
The New phytologist, 2019Co-Authors: Ying Chang, Alicia Clum, Igor V. Grigoriev, Francis Martin, Alessandro Desirò, Laura Sandor, Anna Lipzen, Kerrie Barry, Jason E. StajichAbstract:Endogonales (Mucoromycotina), composed of Endogonaceae and Densosporaceae, is the only known non-Dikarya order with ectomycorrhizal members. They also form mycorrhizal-like association with some nonspermatophyte plants. It has been recently proposed that Endogonales were among the earliest mycorrhizal partners with land plants. It remains unknown whether Endogonales possess genomes with mycorrhizal-lifestyle signatures and whether Endogonales originated around the same time as land plants did. We sampled sporocarp tissue from four Endogonaceae collections and performed shotgun genome sequencing. After binning the metagenome data, we assembled and annotated the Endogonaceae genomes. We performed comparative analysis on plant-cell-wall-degrading enzymes (PCWDEs) and small secreted proteins (SSPs). We inferred phylogenetic placement of Endogonaceae and estimated the ages of Endogonaceae and Endogonales with expanded taxon sampling. Endogonaceae have large genomes with high repeat content, low diversity of PCWDEs, but without elevated SSP/secretome ratios. Dating analysis estimated that Endogonaceae originated in the Permian-Triassic boundary and Endogonales originated in the mid-late Silurian. Mycoplasma-related endobacterium sequences were identified in three Endogonaceae genomes. Endogonaceae genomes possess typical signatures of mycorrhizal lifestyle. The early origin of Endogonales suggests that the mycorrhizal association between Endogonales and plants might have played an important role during the colonization of land by plants.
-
Broad‐specificity GH131 β‐glucanases are a hallmark of Fungi and Oomycetes that colonise plants
Environmental Microbiology, 2019Co-Authors: Georgios Anasontzis, Robert Riley, Marc-henri Lebrun, Mireille Haon, Charlotte Champion, Annegret Kohler, Nicolas Lenfant, Francis Martin, Richard O'connell, Igor V. GrigorievAbstract:Plant-tissue-colonising fungi fine-tune the deconstruction of plant-cell walls (PCW) using different sets of enzymes according to their lifestyle. However, some of these enzymes are conserved among fungi with dissimilar lifestyles. We identified genes from Glycoside Hydrolase family GH131 as commonly expressed during plant-tissue colonisation by saprobic, pathogenic, and symbiotic fungi. By searching all the publicly available genomes, we found that GH131-coding genes were widely distributed in the Dikarya subkingdom, except in Taphrinomycotina and Saccharomycotina, and in phytopathogenic Oomycetes, but no other eukaryotes nor prokaryotes. The presence of GH131 in a species was correlated with its association with plants as symbiont, pathogen, or saprobe. We propose that GH131-family expansions and horizontal-gene transfers contributed to this adaptation. We analysed the biochemical activities of GH131 enzymes whose genes were up-regulated during plant-tissue colonisation in a saprobe (Pycnoporus sanguineus), a plant symbiont (Laccaria bicolor), and three hemibiotrophic-plant pathogens (Colletotrichum higginsianum, C. graminicola, Zymoseptoria tritici). These enzymes were all active on substrates with β-1,4, β-1,3, and mixed β-1,4/1,3 glucosidic linkages. Combined with a cellobiohydrolase, GH131 enzymes enhanced cellulose degradation. We propose that secreted GH131 enzymes unlock the PCW barrier and allow further deconstruction by other enzymes during plant tissue colonisation by symbionts, pathogens and saprobes.
-
The Fungal Kingdom - The Fungal Tree of Life: from Molecular Systematics to Genome-Scale Phylogenies.
Microbiology spectrum, 2017Co-Authors: Joseph W. Spatafora, Igor V. Grigoriev, M. Catherine Aime, Francis Martin, Jason E. Stajich, Meredith BlackwellAbstract:The kingdom Fungi is one of the more diverse clades of eukaryotes in terrestrial ecosystems, where they provide numerous ecological services ranging from decomposition of organic matter and nutrient cycling to beneficial and antagonistic associations with plants and animals. The evolutionary relationships of the kingdom have represented some of the more recalcitrant problems in systematics and phylogenetics. The advent of molecular phylogenetics, and more recently phylogenomics, has greatly advanced our understanding of the patterns and processes associated with fungal evolution, however. In this article, we review the major phyla, subphyla, and classes of the kingdom Fungi and provide brief summaries of ecologies, morphologies, and exemplar taxa. We also provide examples of how molecular phylogenetics and evolutionary genomics have advanced our understanding of fungal evolution within each of the phyla and some of the major classes. In the current classification we recognize 8 phyla, 12 subphyla, and 46 classes within the kingdom. The ancestor of fungi is inferred to be zoosporic, and zoosporic fungi comprise three lineages that are paraphyletic to the remainder of fungi. Fungi historically classified as zygomycetes do not form a monophyletic group and are paraphyletic to Ascomycota and Basidiomycota. Ascomycota and Basidiomycota are each monophyletic and collectively form the subkingdom Dikarya.