The Experts below are selected from a list of 102 Experts worldwide ranked by ideXlab platform
P. H. Gregory - One of the best experts on this subject based on the ideXlab platform.
-
Experiments on the spread of rugose mosaic and Leaf Roll in potato crops in 1946.
The Annals of applied biology, 2008Co-Authors: L. Broadbent, P. H. GregoryAbstract:A series of experiments on the spread of potato rugose mosaic (virus Y), and Leaf Roll, which has been in progress on a uniform plan since 1943, was ended in 1946. Mean values for thirteen centres in England and Wales showed that in 1946 69% of the infections with virus Yand 48 % of those with Leaf-Roll virus reached the tubers of Majestic potatoes by the beginning of August. There was usually little subsequent increase of rugose mosaic, but a late increase of Leaf Roll was associated with a relatively high initial spread. Three-quarters of the virus Y and over half the Leaf-Roll infections occurred within five plants distance of the source. There was no close correlation between the spread of either virus and the maximum number of Myzus persicae, either apterous forms on the plants or alate forms caught on adhesive traps, but centres with high trap catches in July and August showed pronounced late season spread of Leaf Roll. There were marked differences at different centres in the relative spread of the two viruses. The amount of spread and the gradients from source of infection of the two viruses are compared over the period 1943–6.
L. Broadbent - One of the best experts on this subject based on the ideXlab platform.
-
Experiments on the spread of rugose mosaic and Leaf Roll in potato crops in 1946.
The Annals of applied biology, 2008Co-Authors: L. Broadbent, P. H. GregoryAbstract:A series of experiments on the spread of potato rugose mosaic (virus Y), and Leaf Roll, which has been in progress on a uniform plan since 1943, was ended in 1946. Mean values for thirteen centres in England and Wales showed that in 1946 69% of the infections with virus Yand 48 % of those with Leaf-Roll virus reached the tubers of Majestic potatoes by the beginning of August. There was usually little subsequent increase of rugose mosaic, but a late increase of Leaf Roll was associated with a relatively high initial spread. Three-quarters of the virus Y and over half the Leaf-Roll infections occurred within five plants distance of the source. There was no close correlation between the spread of either virus and the maximum number of Myzus persicae, either apterous forms on the plants or alate forms caught on adhesive traps, but centres with high trap catches in July and August showed pronounced late season spread of Leaf Roll. There were marked differences at different centres in the relative spread of the two viruses. The amount of spread and the gradients from source of infection of the two viruses are compared over the period 1943–6.
Carmen Büttner - One of the best experts on this subject based on the ideXlab platform.
-
A novel badnavirus discovered from Betula sp. affected by birch Leaf-Roll disease.
PloS one, 2018Co-Authors: Artemis Rumbou, Thierry Candresse, Sébastien Theil, Juliane Langer, Risto Jalkanen, Carmen BüttnerAbstract:In declining birches (Betula sp.) from different European stands affected by the “birch Leaf-Roll disease” (BLRD) a novel virus is identified by means of RNA-Seq virome analysis. The virus represents a new member in the genus Badnavirus, family Caulimoviridae, tentatively named Birch Leaf Roll-associated virus (BLRaV) and it is the first badnavirus found to infect birch. Complete genome sequences (7,862–7,864 nucleotides) of three viral isolates of Finnish and German origin have been determined. The virus sequences show a typical badnavirus organization with three major open reading frames (ORFs) and a fourth potential ORF overlapping with the end of ORF3. ORFs 1-2-3 show low level of amino acid identity to the corresponding proteins encoded by other badnaviruses, reaching a maximum of 44% identity (ORF3). Grapevine vein-clearing virus appears as the closest badnavirus when considering the polymerase region. So far, we can exclude evidence for presence of endogenous BLRaV elements in the birch genome, while evidence for the episomal activity of BLRaV is provided. The viral population holds significant haplotype diversity, while co-infection by different BLRaV variants are observed in single hosts. BLRaV presence is associated with the BLRD in both silver (B. pendula) and downy birch (B. pubescens). These results challenge the earlier hypothesis of a causal role of Cherry Leaf Roll virus in BLRD. Further work is now needed to finally prove that BLRaV is the causal agent for the BLRD.
-
List of samples used for RNA-Seq analysis including NGS data generated for the new badnavirus and for Cherry Leaf Roll virus.
2018Co-Authors: Artemis Rumbou, Thierry Candresse, Sébastien Theil, Juliane Langer, Risto Jalkanen, Armelle Marais, Carmen BüttnerAbstract:List of samples used for RNA-Seq analysis including NGS data generated for the new badnavirus and for Cherry Leaf Roll virus.
-
High genetic variation in a small population of Cherry Leaf Roll virus in Betula sp. of montane origin in Corsica
Forest Pathology, 2016Co-Authors: Juliane Langer, Artemis Rumbou, Susanne Von Bargen, A. Fauter, Carmen BüttnerAbstract:Summary Cherry Leaf Roll virus (CLRV) infection is common in Betula pendula and B. pubescens in Middle and North Europe, easily observable by chlorotic Leaf vein banding, mottling and Leaf Roll, partially adherent with progressive loss of vitality or death of twigs and branches. In Fennoscandia, a severe viral epidemic in various birch species in forest stands, public greens and roadsides is associated with CLRV. In Corsica, CLRV-typical symptoms were observed on birch trees (Betula sp.) in a montane stand (1470 m) at Col de Vergio. CLRV was detected by RT-nested PCR in all Leaf samples from 11 randomly selected birch trees exhibiting characteristic symptoms. Along with the fact that this is the first report of CLRV in Betula sp. of both montane and Mediterranean origins, remarkably high genetic variation and a new distinct phylogenetic cluster are comprised by a small randomly sampled CLRV population that has evolved in one of the few scattered birch stands in Corsica.
-
High genetic diversity at the inter-/intra-host level of Cherry Leaf Roll virus population associated with the birch Leaf-Roll disease in Fennoscandia
Scandinavian Journal of Forest Research, 2016Co-Authors: Artemis Rumbou, Juliane Langer, Risto Jalkanen, Susanne Von Bargen, Rana Demiral, Markus Rott, Carmen BüttnerAbstract:ABSTRACTA viral epidemic associated with the Cherry Leaf Roll virus (CLRV) has emerged in Betula species in Fennoscandia, exhibiting quick and effective spread during the last 15 years. A population genetics approach is chosen in order to characterise the virus diversity and the sources of genetic variation aiming to investigate the epidemiology of the pathogen. In a CLRV population from Rovaniemi urban parks and a population that occurred after infecting young Betula seedlings with scions from the original Finnish trees, the genetic diversity is found to be remarkably high, mixed infections by CLRV variants from different phylogenetic groups are detected in single trees, while recombination is evidenced to occur. The estimated genetic variability is high and the CLRV haplotypes detected exhibit clear clustering and belong to different phylogenetic groups. The structure of the viral population reveals a pathogen with high evolutionary potential assumed to carry on its effective spread.
-
Cherry Leaf Roll virus - an Emerging Virus in Finland?
Silva Fennica, 2009Co-Authors: Susanne Von Bargen, Risto Jalkanen, Elise Grubits, Carmen BüttnerAbstract:Cherry Leaf Roll virus, CLRV, is a plant pathogen that infects a variety of deciduous trees and shrubs in temperate regions. Little is known about its occurrence at high latitudes and especially in Finnish birch species. Still, symptoms that seemed to be associated with CLRV such as vein banding, Leaf Roll and decline have been observed in birch trees throughout the country since the summer of 2002. Six different birch species, subspecies or varieties, i.e. Betula pubescens subsp. pubescens (downy birch), B. pendula (silver birch), B. nana (dwarf birch), B. pubescens var. appressa (Kiilopaa birch), B. pubescens subsp. czerepanovii (mountain birch) and B. pendula var. carelica (curly birch) originating from all over Finland were assessed by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) for CLRV infection. It was shown that CLRV is widely distributed in B. pendula and B. pubescens throughout the country. Furthermore, dwarf birch, mountain birch, Kiilopaa birch and curly birch were confirmed to be previously unkown hosts of CLRV. Genetic analysis of virus sequence variants originating from Finnish birch trees revealed atypical phylogenetic relationships. In contrast to CLRV isolates from birches growing in the United Kingdom and Germany which clustered exclusively within group A, Finnish CLRV isolates belonged either to group B, D or E. Thus, virus population structure in Finnish birches seems to be more variable and host plant dependency seems not to apply for Finnish CLRV isolates.
Michael A. Ellis - One of the best experts on this subject based on the ideXlab platform.
-
First Report of Grapevine Leaf Roll-associated virus-2 and -3 in Ohio Vineyards.
Plant disease, 2014Co-Authors: J. Han, Michael A. EllisAbstract:Grapevine Leaf Roll-associated viruses (GLRaVs) are a group of nine closely related viruses belonging to the Closteroviridae family that cause grapevine Leaf Roll disease in vineyards across the world (3). Within the continental United States, GLRaVs have been reported in the states of California, Michigan, Missouri, New York, Oregon, Washington, and Wisconsin, but not in Ohio (2,3). During 2012, grapevines with typical Leaf Roll symptoms were reported by owners of several Ohio vineyards. The symptoms included small, red leaves and downwardly Rolled Leaf margins, accompanied by tiny grape clusters with few fruits. A total of 20 symptomatic Leaf samples were collected from two sites about 300 miles apart within Ohio, namely Valley Vineyards (cultivars Vidal Blanc and Fronterac) and South River Winery (cultivar Cabernet Franc). Total RNA was extracted from the samples using a previously reported procedure (1) and subjected to reverse transcription (RT)-PCR using specific primers for five known grapevine viruses including GLRaV-1 (1F: 5'-ACCTGGTTGAACGAGATCGCTT and 1R: 5'-GTAAACGGGTGTTCTTCAATTCTCT), GLRaV-2 [2F(FQ): 5'-GCTCCTAACGAGGGTATAGAAG and 2R(FQ): 5'-AGAGCGTACATACTCGCGAACAT], GLRaV-3 [3F(FQ): CAAGTGCTCTAGTTAAGGTCAG and 3R(FQ): 5'-CGGAACGTCGGTTCATTTAGA], Grapevine fan Leaf virus (GFLVR1-F: 5'-TGAGATTAGTCATGGAGCAGCTT and GFLVR1-R: 5'-GGATAGACGTCTGGTTGATTTTG), and Tobacco ring spot virus (TRSVR1-1255F: 5'-GAGTGTTGTGCAATTATCT-GCATA and TRSVR1-1844R: 5'-CAAAGATGCCAAGAAAAGTTGCAAG). A 295-bp fragment of a grapevine actin cDNA (primers VvACT-F: 5'-ATCTCCATGTCAACCAAACTGAG and VvACT-R: 5'-GACAGAATGAGCAAGGAAATCAC) was used as a positive control for RT-PCR. The samples tested negative for GFLV, TRSV, or GLRaV-1 with our primer sets. However, four of the samples were positive for GLRaV-2, and 12 positive for GLRaV-3, as evidenced by the detection of PCR fragments of expected sizes (404 and 344 bp, respectively). All samples positive for GLRaV-2 were from a single field, whereas samples positive for GLRaV-3 were from both vineyards examined. The identities of GLRaV-2 and -3 were further confirmed by directly sequencing one GLRaV-2 and two GLRaV-3 (one from each location) PCR fragments from both ends. The 404 bp GLRaV-2-specific fragment shared 95 to 98% sequence identity with various GLRaV-2 isolates whose sequences were deposited at the GenBank. Similarly, the two 344-bp GLRaV-3 fragments share a 95 to 97% identity with known GLRaV-3 isolates. Notably, the sequences of the two GLRaV-3-specific fragments derived from two vineyards are not identical (97% identity), suggesting these two isolates might have different origins. As these viruses are known to be recalcitrant to mechanical transmission, we did not attempt to transmit these viruses to healthy plants. In summary, our results report for the first time the detection of GLRaV-2 and -3 in Ohio, suggesting that these two viruses are associated with the observed Leaf Roll symptoms, hence should be part of an effective management plan for grapevine viral diseases in the state. References: (1) C. Louime et al. Eur. J. Sci. Res. 22:232, 2008. (2) S. Lunden and W. Qiu. Plant Dis. 96:462, 2012. (3) A. M. Sharma et al. PLoS One 6:e26227, 2011.
T. R. Davidson - One of the best experts on this subject based on the ideXlab platform.
-
Rate of Development of Potato Leaf-Roll Vine Symptoms1
Canadian Journal of Agricultural Science, 2016Co-Authors: T. R. DavidsonAbstract:Under greenhouse conditions and air temperature of about 68° F., the virus of potato Leaf-Roll, as indicated by vine symptoms, was effectively transferred by Myzus persicae to 85 per cent of young plants in from 15 to 17 days and to 100 per cent of them in 18 days Stem graft inoculation was also effective, but, in general, it required about 5 days longer for symptoms to develop. This delay might be caused by the relatively slow union of the severed phloem elements of test plants
-
Expression of Leaf-Roll Phloem Necrosis in Potato Tubers1
Canadian Journal of Agricultural Science, 2016Co-Authors: T. R. Davidson, G. B. SanfordAbstract:The development of potato tuber Leaf-Roll phloem necrosis in relation to the period when the growing plant becomes infected was studied for four years in field experiments. The susceptible varieties, Carter’s Early Favorite and Netted Gem, were graft-inoculated at 10-day intervals beginning with very young plants. The expression of tuber phloem necrosis was very low for early inoculations, but gradually increased during July, until the peak-period during the time of most rapid growth of the tubers, which in these experiments was about mid-August. This conclusion is based on the percentage of the inoculated plants that developed affected tubers, the percentage of affected tubers per plant and to some extent on the amount of necrosis in the tubers.
