The Experts below are selected from a list of 1575 Experts worldwide ranked by ideXlab platform
Serge L. Beaucage - One of the best experts on this subject based on the ideXlab platform.
-
assessment of the cellular internalization of thermolytic phosphorothioate dna oligonucleotide prodrugs
Bioorganic & Medicinal Chemistry, 2013Co-Authors: Harsh V Jain, Kazuyo Takeda, Cecilia Tami, Daniela Verthelyi, Serge L. BeaucageAbstract:Abstract The bioactivity of a CpG-containing phosphorothioate DNA oligonucleotide with thermolytic 2-( N -formyl- N -methylamino)ethyl ( fma ) Thiophosphate groups in mice led us to investigate the parameters affecting the internalization of these thermosensitive DNA prodrugs in various cell lines. Flow cytometry and confocal microscopy analyses indicate that 5′-fluoresceinated fma -phosphorothioate DNA sequences are poorly internalized in Vero, HeLa and GC-2 cells. However, when four fma -Thiophosphate groups of a 15-nucleotide long oligothymidylate prodrug are replaced with 3-( N , N -dimethylamino)prop-1-yl Thiophosphate functions, internalization of the positively charged prodrug, under physiological conditions, increased fourfold in HeLa and 40-fold in Vero or GC-2 cells. No cytotoxic effects are observed in Vero cells even at an extracellular prodrug concentration of 50 μM over a period of 72 h. Confocal microscopy studies show that internalization of the positively charged oligothymidylate prodrug in Vero cells is time-dependent with early trafficking of the DNA sequence through endosomal vesicles and, eventually, to the nucleus of the cells. Thus, the incorporation of four 3-( N , N -dimethylamino)prop-1-yl Thiophosphate groups into thermosentive fma -phosphorothioate DNA prodrugs is an attractive strategy for efficient cellular internalization of these nucleic acid-based drugs for potential therapeutic indications.
-
solid phase synthesis of thermolytic dna oligonucleotides functionalized with a single 4 hydroxy 1 butyl or 4 phosphato thiophosphato 1 butyl Thiophosphate protecting group
Journal of Organic Chemistry, 2007Co-Authors: Andrzej Grajkowski, Cristina Ausin, Jon S Kauffman, John K Snyder, Sonja Hess, John R Lloyd, Serge L. BeaucageAbstract:Several thermolytic CpG-containing DNA oligonucleotides analogous to 1 have been synthesized to serve as potential immunotherapeutic oligonucleotide prodrug formulations for the treatment of infectious diseases in animal models. Specifically, the CpG motif (GACGTT) of each DNA oligonucleotide has been functionalized with either the thermolabile 4-hydroxy-1-butyl or the 4-phosphato-/thiophosphato-1-butyl Thiophosphate protecting group. This functionalization was achieved through incorporation of activated deoxyribonucleoside phosphoramidite 8b into the oligonucleotide chain during solid-phase synthesis and, optionally, through subsequent phosphorylation effected by phosphoramidite 9. Complete conversion of CpG ODNs hbu1555, psb1555, and pob1555 to CpG ODN 1555 (homologous to 2) occurred under elevated temperature conditions, thereby validating the function of these diastereomeric oligonucleotides as prodrugs in vitro. Noteworthy is the significant increase in solubility of CpG ODN psb1555 and CpG pob1555 i...
-
thermolytic 4 methylthio 1 butyl group for phosphate Thiophosphate protection in solid phase synthesis of dna oligonucleotides
Journal of Organic Chemistry, 2004Co-Authors: Jacek Cieślak, Andrzej Grajkowski, And Victor Livengood, Serge L. BeaucageAbstract:The thermolabile 4-methylthio-1-butyl phosphate/Thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a “heat-driven” process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a−d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/Thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 °C in an aqueous buffer under neutral conditions or within 2 h at 55 °C in concentrated NH4OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides an...
-
thermolytic properties of 3 2 pyridyl 1 propyl and 2 n methyl n 2 pyridyl aminoethyl phosphate Thiophosphate protecting groups in solid phase synthesis of oligodeoxyribonucleotides
Journal of Organic Chemistry, 2003Co-Authors: Jacek Cieślak, Serge L. BeaucageAbstract:Thermolytic groups may serve as alternatives to the conventional 2-cyanoethyl group for phosphate/Thiophosphate protection in solid-phase oligonucleotide synthesis to prevent DNA alkylation by acrylonitrile generated under the basic conditions used for oligonucleotide deprotection. Additionally, thermolytic groups are attractive in the context of engineering a "heat-driven" process for the synthesis of oligonucleotides on diagnostic microarrays. In these regards, the potential application of pyridine derivatives as thermolytic phosphate/Thiophosphate protecting groups has been investigated. Specifically, 2-pyridinepropanol and 2-[N-methyl-N-(2-pyridyl)]aminoethanol were incorporated into deoxyribonucleoside phosphoramidites 7a-d and 9, which were found as efficient as 2-cyanoethyl deoxyribonucleoside phosphoramidites in solid-phase oligonucleotide synthesis. Whereas the removal of 3-(2-pyridyl)-1-propyl phosphate/Thiophosphate protecting groups from oligonucleotides is effected within 30 min upon heating at 55 degrees C in concentrated NH4OH or in an aqueous buffer at pH 7.0, cleavage of 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups occurs spontaneously when their phosphate or phosphorothioate esters are formed during oligonucleotide synthesis. The deprotection of these groups follows a cyclodeesterification process generating the bicyclic salts 13 and 14 as side products. These salts do not alkylate or otherwise modify any DNA nucleobases and do not desulfurize a phosphorothioate diester model under conditions mimicking large-scale oligonucleotide deprotection.
-
the 3 n tert butylcarboxamido 1 propyl group as an attractive phosphate Thiophosphate protecting group for solid phase oligodeoxyribonucleotide synthesis
Journal of Organic Chemistry, 2002Co-Authors: Andrzej Wilk, Marcin K. Chmielewski, Andrzej Grajkowski, Lawrence R. Phillips, Serge L. BeaucageAbstract:Among the various phosphate/Thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/Thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/Thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.
Chuangtian Chen - One of the best experts on this subject based on the ideXlab platform.
-
metal Thiophosphates with good mid infrared nonlinear optical performances a first principles prediction and analysis
Journal of the American Chemical Society, 2015Co-Authors: Lei Kang, Molin Zhou, Jiyong Yao, Zheshuai Lin, Chuangtian ChenAbstract:The family of metal Thiophosphates is an important but long-ignored compound system of the nonlinear optical (NLO) materials with desirable properties for the mid-infrared (mid-IR) coherent light generation. In the present work, the mid-IR NLO capabilities of metal Thiophosphate crystals are systematically investigated based on their structure–property relationship. The linear and nonlinear optical properties of these crystals are predicted and analyzed using the first-principles calculations. In particular, several metal Thiophosphate compounds are highlighted to exhibit good mid-IR NLO performances, as supported by the primary experimental results. These candidates would greatly promote the development of the mid-IR NLO functional materials.
-
Metal Thiophosphates with Good Mid-infrared Nonlinear Optical Performances: A First-Principles Prediction and Analysis
2015Co-Authors: Lei Kang, Molin Zhou, Jiyong Yao, Zheshuai Lin, Chuangtian ChenAbstract:The family of metal Thiophosphates is an important but long-ignored compound system of the nonlinear optical (NLO) materials with desirable properties for the mid-infrared (mid-IR) coherent light generation. In the present work, the mid-IR NLO capabilities of metal Thiophosphate crystals are systematically investigated based on their structure–property relationship. The linear and nonlinear optical properties of these crystals are predicted and analyzed using the first-principles calculations. In particular, several metal Thiophosphate compounds are highlighted to exhibit good mid-IR NLO performances, as supported by the primary experimental results. These candidates would greatly promote the development of the mid-IR NLO functional materials
Wolfgang Siess - One of the best experts on this subject based on the ideXlab platform.
-
synthesis structure activity relationships and biological evaluation of fatty alcohol phosphates as lysophosphatidic acid receptor ligands activators of pparγ and inhibitors of autotaxin
Journal of Medicinal Chemistry, 2005Co-Authors: Gangadhar G Durgam, Tamas Virag, Michelle D Walker, Ryoko Tsukahara, Satoshi Yasuda, Karoly Liliom, Laurens A Van Meeteren, Wouter H Moolenaar, Nicole Wilke, Wolfgang SiessAbstract:We previously reported that fatty alcohol phosphates (FAP) represent a minimal pharmacophore required to interact with lysophosphatidic acid (LPA) receptors. To improve the activity of the first-generation saturated FAP series, a structure−activity relationship (SAR) study was carried out that includes modifications to the headgroup and alkyl side chain of the FAP pharmacophore. A series of unsaturated (C10−C18) FAP, headgroup-modified hydrolytically stable saturated (C10−C18) alkyl phosphonates, and saturated and unsaturated (C10−C18) Thiophosphate analogues were synthesized and evaluated for activity in RH7777 cells transfected with individual LPA1-3 receptors, in PC-3 cells and in human platelets that endogenously express all three isoforms. In this series we identified several LPA1- and LPA3-selective antagonists with IC50 values in the nanomolar range. Oleoyl-Thiophosphate (15g) was shown to be a pan-agonist, whereas tetradecyl-phosphonate (16c) was identified as a pan-antagonist. These compounds wer...
-
synthesis structure activity relationships and biological evaluation of fatty alcohol phosphates as lysophosphatidic acid receptor ligands activators of pparγ and inhibitors of autotaxin
Journal of Medicinal Chemistry, 2005Co-Authors: Gangadhar G Durgam, Tamas Virag, Michelle D Walker, Ryoko Tsukahara, Satoshi Yasuda, Karoly Liliom, Laurens A Van Meeteren, Wouter H Moolenaar, Nicole Wilke, Wolfgang SiessAbstract:We previously reported that fatty alcohol phosphates (FAP) represent a minimal pharmacophore required to interact with lysophosphatidic acid (LPA) receptors. To improve the activity of the first-generation saturated FAP series, a structure-activity relationship (SAR) study was carried out that includes modifications to the headgroup and alkyl side chain of the FAP pharmacophore. A series of unsaturated (C(10)-C(18)) FAP, headgroup-modified hydrolytically stable saturated (C(10)-C(18)) alkyl phosphonates, and saturated and unsaturated (C(10)-C(18)) Thiophosphate analogues were synthesized and evaluated for activity in RH7777 cells transfected with individual LPA(1)(-3) receptors, in PC-3 cells and in human platelets that endogenously express all three isoforms. In this series we identified several LPA(1)- and LPA(3)-selective antagonists with IC(50) values in the nanomolar range. Oleoyl-Thiophosphate (15g) was shown to be a pan-agonist, whereas tetradecyl-phosphonate (16c) was identified as a pan-antagonist. These compounds were also tested for the ability to activate the transcription factor PPARgamma, an intracellular receptor for LPA, in CV1 cells transfected with the PPRE-Acox-Rluc reporter gene. All the FAP tested, along with the previously reported LPA GPCR antagonists dioctanoyl glycerol pyrophosphate (2), Ki16425 (6), and the agonist OMPT (3), were activators of PPARgamma. The pan-agonist oleoyl-Thiophosphate (15g) and pan-antagonist tetradecyl-phosphonate (16c) mimicked LPA in inhibiting autotaxin, a secreted lysophospholipase D that produces LPA in biological fluids.
Andrzej Grajkowski - One of the best experts on this subject based on the ideXlab platform.
-
solid phase synthesis of thermolytic dna oligonucleotides functionalized with a single 4 hydroxy 1 butyl or 4 phosphato thiophosphato 1 butyl Thiophosphate protecting group
Journal of Organic Chemistry, 2007Co-Authors: Andrzej Grajkowski, Cristina Ausin, Jon S Kauffman, John K Snyder, Sonja Hess, John R Lloyd, Serge L. BeaucageAbstract:Several thermolytic CpG-containing DNA oligonucleotides analogous to 1 have been synthesized to serve as potential immunotherapeutic oligonucleotide prodrug formulations for the treatment of infectious diseases in animal models. Specifically, the CpG motif (GACGTT) of each DNA oligonucleotide has been functionalized with either the thermolabile 4-hydroxy-1-butyl or the 4-phosphato-/thiophosphato-1-butyl Thiophosphate protecting group. This functionalization was achieved through incorporation of activated deoxyribonucleoside phosphoramidite 8b into the oligonucleotide chain during solid-phase synthesis and, optionally, through subsequent phosphorylation effected by phosphoramidite 9. Complete conversion of CpG ODNs hbu1555, psb1555, and pob1555 to CpG ODN 1555 (homologous to 2) occurred under elevated temperature conditions, thereby validating the function of these diastereomeric oligonucleotides as prodrugs in vitro. Noteworthy is the significant increase in solubility of CpG ODN psb1555 and CpG pob1555 i...
-
thermolytic 4 methylthio 1 butyl group for phosphate Thiophosphate protection in solid phase synthesis of dna oligonucleotides
Journal of Organic Chemistry, 2004Co-Authors: Jacek Cieślak, Andrzej Grajkowski, And Victor Livengood, Serge L. BeaucageAbstract:The thermolabile 4-methylthio-1-butyl phosphate/Thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a “heat-driven” process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a−d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/Thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 °C in an aqueous buffer under neutral conditions or within 2 h at 55 °C in concentrated NH4OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides an...
-
the 3 n tert butylcarboxamido 1 propyl group as an attractive phosphate Thiophosphate protecting group for solid phase oligodeoxyribonucleotide synthesis
Journal of Organic Chemistry, 2002Co-Authors: Andrzej Wilk, Marcin K. Chmielewski, Andrzej Grajkowski, Lawrence R. Phillips, Serge L. BeaucageAbstract:Among the various phosphate/Thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/Thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/Thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.
-
the 4 oxopentyl group as a labile phosphate Thiophosphate protecting group for synthetic oligodeoxyribonucleotides
Tetrahedron Letters, 2001Co-Authors: Andrzej Wilk, Marcin K. Chmielewski, Andrzej Grajkowski, Lawrence R. Phillips, Serge L. BeaucageAbstract:Abstract An efficient and economical method for the solid-phase synthesis of oligodeoxyribonucleotides and their phosphorothioate analogues is described. The method entails the use of the 4-oxopentyl group for phosphate/Thiophosphate protection. Post-synthesis removal of the protecting group is easily and rapidly achieved under mild conditions at ambient temperature using either pressurized gaseous amines or concentrated ammonium hydroxide.
Lei Kang - One of the best experts on this subject based on the ideXlab platform.
-
metal Thiophosphates with good mid infrared nonlinear optical performances a first principles prediction and analysis
Journal of the American Chemical Society, 2015Co-Authors: Lei Kang, Molin Zhou, Jiyong Yao, Zheshuai Lin, Chuangtian ChenAbstract:The family of metal Thiophosphates is an important but long-ignored compound system of the nonlinear optical (NLO) materials with desirable properties for the mid-infrared (mid-IR) coherent light generation. In the present work, the mid-IR NLO capabilities of metal Thiophosphate crystals are systematically investigated based on their structure–property relationship. The linear and nonlinear optical properties of these crystals are predicted and analyzed using the first-principles calculations. In particular, several metal Thiophosphate compounds are highlighted to exhibit good mid-IR NLO performances, as supported by the primary experimental results. These candidates would greatly promote the development of the mid-IR NLO functional materials.
-
Metal Thiophosphates with Good Mid-infrared Nonlinear Optical Performances: A First-Principles Prediction and Analysis
2015Co-Authors: Lei Kang, Molin Zhou, Jiyong Yao, Zheshuai Lin, Chuangtian ChenAbstract:The family of metal Thiophosphates is an important but long-ignored compound system of the nonlinear optical (NLO) materials with desirable properties for the mid-infrared (mid-IR) coherent light generation. In the present work, the mid-IR NLO capabilities of metal Thiophosphate crystals are systematically investigated based on their structure–property relationship. The linear and nonlinear optical properties of these crystals are predicted and analyzed using the first-principles calculations. In particular, several metal Thiophosphate compounds are highlighted to exhibit good mid-IR NLO performances, as supported by the primary experimental results. These candidates would greatly promote the development of the mid-IR NLO functional materials
