The Experts below are selected from a list of 1332 Experts worldwide ranked by ideXlab platform
Arthur M. Krieg - One of the best experts on this subject based on the ideXlab platform.
-
immunotherapeutic applications of CpG Oligodeoxynucleotide tlr9 agonists
Advanced Drug Delivery Reviews, 2009Co-Authors: Jorg Vollmer, Arthur M. KriegAbstract:Toll-like receptor 9 (TLR9) agonists have demonstrated substantial potential as vaccine adjuvants, and as mono- or combination therapies for the treatment of cancer and infectious and allergic diseases. Commonly referred to as CpG Oligodeoxynucleotides (ODN), TLR9 agonists directly induce the activation and maturation of plasmacytoid dendritic cells and enhance differentiation of B cells into antibody-secreting plasma cells. Preclinical and early clinical data support the use of TLR9 agonists as vaccine adjuvants, where they can enhance both the humoral and cellular responses to diverse antigens. In mouse tumor models TLR9 agonists have shown activity not only as monotherapy, but also in combination with multiple other therapies including vaccines, antibodies, cellular therapies, other immunotherapies, antiangiogenic agents, radiotherapy, cryotherapy, and some chemotherapies. Phase I and II clinical trials have indicated that these agents have antitumor activity as single agents and enhance the development of antitumor T-cell responses when used as therapeutic vaccine adjuvants. CpG ODN have shown benefit in multiple rodent and primate models of asthma and other allergic diseases, with encouraging results in some early human clinical trials. Although their potential clinical contributions are enormous, the safety and efficacy of these TLR9 agonists in humans remain to be determined.
-
CpG Oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague
Vaccine, 2009Co-Authors: Kei Amemiya, Patricia L. Worsham, Bradford S. Powell, Jennifer L. Meyers, Taralyn E. Rogers, Randy L. Fast, Anthony D. Bassett, Sarah L. Norris, Arthur M. KriegAbstract:Abstract The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG Oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague ( P
-
rapid and strong human cd8 t cell responses to vaccination with peptide ifa and CpG Oligodeoxynucleotide 7909
Journal of Clinical Investigation, 2005Co-Authors: Daniel E Speiser, Arthur M. Krieg, Danielle Lienard, Nathalie Rufer, Verena Rubiogodoy, Donata Rimoldi, Ferdy Lejeune, Jeancharles Cerottini, Pedro RomeroAbstract:The induction of potent CD8+ T cell responses by vaccines to fight microbes or tumors remains a major challenge, as many candidates for human vaccines have proved to be poorly immunogenic. Deoxycytidyl-deoxyguanosin Oligodeoxynucleotides (CpG ODNs) trigger Toll-like receptor 9, resulting in dendritic cell maturation that can enhance immunogenicity of peptide-based vaccines in mice. We tested whether a synthetic ODN, CpG 7909, could improve human tumor antigen–specific CD8+ T cell responses. Eight HLA-A2+ melanoma patients received 4 monthly vaccinations of low-dose CpG 7909 mixed with melanoma antigen A (Melan-A; identical to MART-1) analog peptide and incomplete Freund’s adjuvant. All patients exhibited rapid and strong antigen-specific T cell responses: the frequency of Melan-A–specific T cells reached over 3% of circulating CD8+ T cells. This was one order of magnitude higher than the frequency seen in 8 control patients treated similarly but without CpG and 1–3 orders of magnitude higher than that seen in previous studies with synthetic vaccines. The enhanced T cell populations consisted primarily of effector memory cells, which in part secreted IFN-γ and expressed granzyme B and perforin ex vivo. In vitro, T cell clones recognized and killed melanoma cells in an antigen-specific manner. Thus, CpG 7909 is an efficient vaccine adjuvant that promotes strong antigen-specific CD8+ T cell responses in humans.
-
induction of systemic th1 like innate immunity in normal volunteers following subcutaneous but not intravenous administration of CpG 7909 a synthetic b class CpG Oligodeoxynucleotide tlr9 agonist
Journal of Immunotherapy, 2004Co-Authors: Arthur M. Krieg, Susan M Efler, Michael Wittpoth, Mohammed Al J Adhami, Heather L DavisAbstract:: Subcutaneous injection of normal human volunteers with a B-class CpG Oligodeoxynucleotide (ODN) TLR9 agonist, CpG 7909, induced a TH1-like pattern of systemic innate immune activation manifested by expression of IL-6, IL-12p40, IFN-alpha, and IFN-inducible chemokines. Serum IP-10 was found to be the most sensitive assay for subcutaneous CpG 7909 stimulation; its level was significantly increased in all subjects at all dose levels, including the lowest tested dose of just 0.0025 mg/kg. This pattern of chemokine and cytokine induction was markedly different from that previously reported to be induced by TLR9 stimulation in rodents, most likely reflecting species-specific differences in the cell types expressing TLR9. Subcutaneous CpG 7909 injection induced transient shifts in blood neutrophils, lymphocytes, and monocytes, consistent with the increased chemokine expression. Levels of acute phase reactants such as C-reactive protein were also increased. A second subcutaneous CpG 7909 injection administered 2 weeks after the first elicited similar immune responses, showing little or no tolerance to the effects of repeated in vivo TLR9 stimulation. Subjects developed dose-dependent transient injection site reactions and flu-like symptoms but otherwise tolerated injection well, with no evidence of organ toxicity or systemic autoimmunity. The activation of innate immunity was dependent on the route of ODN administration, since intravenous injection caused no such effects. These studies indicate that in vivo activation of TLR9 by subcutaneous administration of CpG 7909 could be a well-tolerated immunotherapeutic approach for induction of TH1 innate immune activation.
-
CpG Oligodeoxynucleotide enhances tumor response to radiation
Cancer Research, 2004Co-Authors: Luka Milas, Arthur M. Krieg, Kathryn A Mason, Hisanori Ariga, Nancy R Hunter, Robert Neal, David Valdecanas, John K WhisnantAbstract:CpG Oligodeoxynucleotides (ODNs) are synthetic DNA sequences containing unmethylated cytosine-guanine motifs with potent immunomodulatory effects. Via Toll-like receptor 9 agonism of dendritic cells and B cells, CpG ODNs induce cytokines, activate natural killer cells, and elicit vigorous T-cell responses that lead to significant antitumor effects, including improved efficacy of chemotherapeutic agents. On the basis of these properties of CpG ODNs, we tested whether they also could enhance tumor response to radiotherapy. Using an immunogenic mouse tumor, designated FSa, the response to radiotherapy was assayed by tumor growth delay and tumor cure rate (TCD50, radiation dose yielding 50% tumor cure rate). Treatments were initiated when established tumors were either 6 or 8 mm in diameter. CpG ODN as a single agent given s.c. peritumorally had little effect on tumor growth; however, it dramatically enhanced tumor growth delay in response to single-dose radiation by a factor of 2.58–2.65. CpG ODN also dramatically improved tumor radiocurability, reducing the TCD50 by a factor of 1.93, from 39.6 (36.1–43.1) Gy to 20.5 (14.3–25.7) Gy. The CpG ODN-induced enhancement of tumor radioresponse was diminished in tumor-bearing mice immunocompromised by sublethal whole-body radiation. Tumors treated with CpG ODN and radiation showed histologic changes characterized by increased necrosis, heavy infiltration by host inflammatory cells (lymphocytes and granulocytes), and reduced tumor cell density. These results show that CpG ODNs are potent enhancers of tumor radioresponse and as such have potential to improve clinical radiotherapy.
Henrieta Scholtzova - One of the best experts on this subject based on the ideXlab platform.
-
class c CpG Oligodeoxynucleotide immunomodulatory response in aged squirrel monkey saimiri boliviensis boliviensis
Frontiers in Aging Neuroscience, 2020Co-Authors: Pramod N. Nehete, Bharti P. Nehete, Sriram Chitta, Henrieta Scholtzova, Lawrence E. Williams, Akash G Patel, Margish Ramani, Thomas WisniewskiAbstract:One means of stimulating the mammalian innate immune system is via Toll-like receptor 9 (TLR9) being exposed to unmethylated cytosine-phosphate-guanine (CpG) DNA, also known as pathogen-associated molecular patterns of microbial origin. Synthetic CpG Oligodeoxynucleotides (ODNs) with defined CpG motifs possess broad immunostimulatory properties that make CpG ODNs suitable as therapeutic interventions in a variety of human disease conditions, including Alzheimer’s disease (AD). Rodent models are often used for preclinical testing of the effectiveness of CpG ODN therapeutic agents for AD and other disorders. However, the translatability of findings in such models is limited due to the significant difference of the distribution of TLR9 between primates and rodents. The squirrel monkey (SQM), a well-established New World non-human primate (NHP), is known to be phylogenetically proximate to humans and develops extensive age-dependent cerebral amyloid angiopathy (CAA), a key pathological feature of AD. Hence, this model is currently being used to test AD therapeutics. In the present study, we conducted the first examination of Class C CpG ODN’s immunomodulatory role in elderly SQMs. We documented the effectiveness of CpG ODN to trigger an immune response in an aged cohort whose immune system is senescent. The specific immune response patterns detected here, closely resembled CpG ODN-induced immunostimulatory patterns observed in prior human studies. Overall, our findings provide critical data regarding the immunomodulatory potential of CpG ODN in this NHP model allowing for future therapeutic trials of innate immunity stimulation via TLR9 agonists for diverse indications including AD therapeutics.
-
class c CpG Oligodeoxynucleotide immunomodulatory response in aged squirrel monkey saimiri boliviensis boliviensis
Frontiers in Aging Neuroscience, 2020Co-Authors: Pramod N. Nehete, Bharti P. Nehete, Sriram Chitta, Henrieta Scholtzova, Lawrence E. Williams, Akash G Patel, Thomas Wisniewski, Margish D RamaniAbstract:One means of stimulating the mammalian innate immune system is via Toll-like receptor 9 (TLR9) being exposed to unmethylated cytosine-phosphate-guanine (CpG) DNA, also known as pathogen-associated molecular patterns (PAMPs) of microbial origin. Synthetic CpG Oligodeoxynucleotides (ODNs) with defined CpG motifs possess broad immunostimulatory properties that make CpG ODNs suitable as therapeutic interventions in a variety of human disease conditions, including Alzheimer's disease (AD). Rodent models are often used to preclinically test the effectiveness of CpG ODN therapeutic agents for AD and other disorders. However, the translatability of findings in such models is limited due to the significant difference of the expression of TLR9 between primates and rodents. The squirrel monkey (SQM), a New World non-human primate (NHP), is known to be phylogenetically proximate to humans, and develops extensive age-dependent cerebral amyloid angiopathy (CAA), a key pathological feature of AD. Hence, this model is currently being used to test AD therapeutics. In the present study, we conducted the first examination of Class C CpG ODN's immunomodulatory role in elderly SQMs. We documented the effectiveness of CpG ODN to trigger an immune response in an aged cohort whose immune system is senescent. The specific immune response patterns detected here closely resembled CpG ODN-induced immunostimulatory patterns observed in prior human studies. Overall, our findings provide critical data regarding the immunomodulatory potential of CpG ODN in this NHP model, allowing for future translational studies of innate immunity stimulation via TLR9 agonists for diverse indications, including AD therapeutics.
Heather L Davis - One of the best experts on this subject based on the ideXlab platform.
-
enhancement of functional antibody responses to ama1 c1 alhydrogel a plasmodium falciparum malaria vaccine with CpG Oligodeoxynucleotide
Vaccine, 2006Co-Authors: Gregory E D Mullen, Hong Zhou, Heather L Davis, Birgitte Giersing, Olubunmi Ajosepopoola, Cheryl Kothe, Joan Aebig, Gelu Dobrescu, Allan Saul, Carole A. LongAbstract:Apical membrane antigen 1 (AMA1) has been shown to be a promising malaria vaccine candidate. The multiallelic AMA1-C1 vaccine currently in Phase 1 trials in the US and Mali contains an equal mixture of the ectodomain portion of recombinant AMA1 from the FVO and 3D7 clones of Plasmodium falciparum, formulated on Alhydrogel. It is hoped that inclusion of a human-optimized CpG Oligodeoxynucleotide (ODN) (CpG 7909) with our existing AMA1-C1/Alhydrogel vaccine will lead to a higher concentration of functional AMA1-C1 antibodies. Preclinical studies were performed in mice, rats and guinea pigs to assess the safety, immunogenicity and functionality of the immune response to AMA1-C1 with Alhydrogel + CpG 7909 compared to antigen with Alhydrogel alone. Day 42 mean anti-AMA1 ELISA titer values derived from individual animals were compared between Alhydrogel and Alhydrogel + CpG 7909 groups at each antigen dose for each species. Sera from Alhydrogel + CpG 7909 groups displayed significantly higher antibody titers (P < 0.025) than their comparable Alhydrogel alone group. Mouse IgG isotype analysis showed that AMA1-C1/Alhydrogel induced a predominately Th2 type response while AMA1-C1/Alhydrogel + CpG 7909 gave a mixed Th1/Th2 type response. When tested for functional activity by in vitro inhibition of parasite invasion, IgG isolated from serum pools of AMA1-C1/Alhydrogel + CpG 7909 animals was more effective against both FVO and 3D7 parasites than an equal concentration of IgG from animals receiving vaccines adjuvanted with Alhydrogel alone. These promising preclinical results have recently led to the start of a Phase 1 trial in the US.
-
induction of systemic th1 like innate immunity in normal volunteers following subcutaneous but not intravenous administration of CpG 7909 a synthetic b class CpG Oligodeoxynucleotide tlr9 agonist
Journal of Immunotherapy, 2004Co-Authors: Arthur M. Krieg, Susan M Efler, Michael Wittpoth, Mohammed Al J Adhami, Heather L DavisAbstract:: Subcutaneous injection of normal human volunteers with a B-class CpG Oligodeoxynucleotide (ODN) TLR9 agonist, CpG 7909, induced a TH1-like pattern of systemic innate immune activation manifested by expression of IL-6, IL-12p40, IFN-alpha, and IFN-inducible chemokines. Serum IP-10 was found to be the most sensitive assay for subcutaneous CpG 7909 stimulation; its level was significantly increased in all subjects at all dose levels, including the lowest tested dose of just 0.0025 mg/kg. This pattern of chemokine and cytokine induction was markedly different from that previously reported to be induced by TLR9 stimulation in rodents, most likely reflecting species-specific differences in the cell types expressing TLR9. Subcutaneous CpG 7909 injection induced transient shifts in blood neutrophils, lymphocytes, and monocytes, consistent with the increased chemokine expression. Levels of acute phase reactants such as C-reactive protein were also increased. A second subcutaneous CpG 7909 injection administered 2 weeks after the first elicited similar immune responses, showing little or no tolerance to the effects of repeated in vivo TLR9 stimulation. Subjects developed dose-dependent transient injection site reactions and flu-like symptoms but otherwise tolerated injection well, with no evidence of organ toxicity or systemic autoimmunity. The activation of innate immunity was dependent on the route of ODN administration, since intravenous injection caused no such effects. These studies indicate that in vivo activation of TLR9 by subcutaneous administration of CpG 7909 could be a well-tolerated immunotherapeutic approach for induction of TH1 innate immune activation.
-
characterization of three CpG Oligodeoxynucleotide classes with distinct immunostimulatory activities
European Journal of Immunology, 2004Co-Authors: Jorg Vollmer, Risini D Weeratna, Paul J Payette, Marion Jurk, Christian Schetter, Meike Laucht, Tanja Wader, Sibylle Tluk, Ming Liu, Heather L DavisAbstract:Oligodeoxynucleotides (ODN) with unmethylated deoxycytidyl-deoxyguanosine (CpG) dinucleotides (CpG ODN) mimic the immunostimulatory activity of bacterial DNA and are recognized by the Toll-like receptor 9 (TLR9). CpG ODN of the B-Class stimulate strong B cell and NK cell activation and cytokine production. The highest degrees of NK stimulation as well as IFN-alpha secretion by plasmacytoid DC were found to occur only with A-Class ODN. A third class of CpG ODN combines the immune effects of A- and B-Class CpG ODN. C-Class ODN strongly stimulate B cell or NK cell activation and IFN-alpha production. In contrast to the A-Class, the C-Class is wholly phosphorothioate, has no poly-G stretches, but has palindromic sequences combined with stimulatory CpG motifs. All classes stimulate TLR9-dependent signaling, but with strikingly different dose-response relationships that are quite in contrast to those observed for IFN-alpha. Effects similar to those on human cells were observed on mouse splenocytes. In contrast, splenocytes from TLR9-deficient mice did not show any response to the three CpG ODN classes. In vivo studies demonstrate that C-Class ODN are very potent Th1 adjuvants. C-Class ODN may represent new therapeutic drugs that combine the effects of A- and B-Class ODN for broad applications in infectious disease or cancer therapy.
-
interleukin 12 and gamma interferon dependent protection against malaria conferred by CpG Oligodeoxynucleotide in mice
Infection and Immunity, 2001Co-Authors: Robert A Gramzinski, Arthur M. Krieg, Heather L Davis, Denise L Doolan, Martha Sedegah, Stephen L HoffmanAbstract:Unmethylated CpG dinucleotides in bacterial DNA or synthetic Oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.
Pramod N. Nehete - One of the best experts on this subject based on the ideXlab platform.
-
class c CpG Oligodeoxynucleotide immunomodulatory response in aged squirrel monkey saimiri boliviensis boliviensis
Frontiers in Aging Neuroscience, 2020Co-Authors: Pramod N. Nehete, Bharti P. Nehete, Sriram Chitta, Henrieta Scholtzova, Lawrence E. Williams, Akash G Patel, Margish Ramani, Thomas WisniewskiAbstract:One means of stimulating the mammalian innate immune system is via Toll-like receptor 9 (TLR9) being exposed to unmethylated cytosine-phosphate-guanine (CpG) DNA, also known as pathogen-associated molecular patterns of microbial origin. Synthetic CpG Oligodeoxynucleotides (ODNs) with defined CpG motifs possess broad immunostimulatory properties that make CpG ODNs suitable as therapeutic interventions in a variety of human disease conditions, including Alzheimer’s disease (AD). Rodent models are often used for preclinical testing of the effectiveness of CpG ODN therapeutic agents for AD and other disorders. However, the translatability of findings in such models is limited due to the significant difference of the distribution of TLR9 between primates and rodents. The squirrel monkey (SQM), a well-established New World non-human primate (NHP), is known to be phylogenetically proximate to humans and develops extensive age-dependent cerebral amyloid angiopathy (CAA), a key pathological feature of AD. Hence, this model is currently being used to test AD therapeutics. In the present study, we conducted the first examination of Class C CpG ODN’s immunomodulatory role in elderly SQMs. We documented the effectiveness of CpG ODN to trigger an immune response in an aged cohort whose immune system is senescent. The specific immune response patterns detected here, closely resembled CpG ODN-induced immunostimulatory patterns observed in prior human studies. Overall, our findings provide critical data regarding the immunomodulatory potential of CpG ODN in this NHP model allowing for future therapeutic trials of innate immunity stimulation via TLR9 agonists for diverse indications including AD therapeutics.
-
class c CpG Oligodeoxynucleotide immunomodulatory response in aged squirrel monkey saimiri boliviensis boliviensis
Frontiers in Aging Neuroscience, 2020Co-Authors: Pramod N. Nehete, Bharti P. Nehete, Sriram Chitta, Henrieta Scholtzova, Lawrence E. Williams, Akash G Patel, Thomas Wisniewski, Margish D RamaniAbstract:One means of stimulating the mammalian innate immune system is via Toll-like receptor 9 (TLR9) being exposed to unmethylated cytosine-phosphate-guanine (CpG) DNA, also known as pathogen-associated molecular patterns (PAMPs) of microbial origin. Synthetic CpG Oligodeoxynucleotides (ODNs) with defined CpG motifs possess broad immunostimulatory properties that make CpG ODNs suitable as therapeutic interventions in a variety of human disease conditions, including Alzheimer's disease (AD). Rodent models are often used to preclinically test the effectiveness of CpG ODN therapeutic agents for AD and other disorders. However, the translatability of findings in such models is limited due to the significant difference of the expression of TLR9 between primates and rodents. The squirrel monkey (SQM), a New World non-human primate (NHP), is known to be phylogenetically proximate to humans, and develops extensive age-dependent cerebral amyloid angiopathy (CAA), a key pathological feature of AD. Hence, this model is currently being used to test AD therapeutics. In the present study, we conducted the first examination of Class C CpG ODN's immunomodulatory role in elderly SQMs. We documented the effectiveness of CpG ODN to trigger an immune response in an aged cohort whose immune system is senescent. The specific immune response patterns detected here closely resembled CpG ODN-induced immunostimulatory patterns observed in prior human studies. Overall, our findings provide critical data regarding the immunomodulatory potential of CpG ODN in this NHP model, allowing for future translational studies of innate immunity stimulation via TLR9 agonists for diverse indications, including AD therapeutics.
Francois Ghiringhelli - One of the best experts on this subject based on the ideXlab platform.
-
tumor destruction using electrochemotherapy followed by CpG Oligodeoxynucleotide injection induces distant tumor responses
Cancer Immunology Immunotherapy, 2008Co-Authors: Stephan Roux, Claire Bernat, Bassim Alsakere, Francois GhiringhelliAbstract:Purpose Electrochemotherapy (ECT) is an effective local therapy of human cutaneous cancers but has no effect on distant untreated tumors. We addressed whether tumor-associated antigens released after ECT could induce an efficient systemic immunity when associated with an appropriate immunoadjuvant.
-
tumor destruction using electrochemotherapy followed by CpG Oligodeoxynucleotide injection induces distant tumor responses
Cancer Immunology Immunotherapy, 2008Co-Authors: Stephan Roux, Claire Bernat, Bassim Alsakere, Francois GhiringhelliAbstract:Electrochemotherapy (ECT) is an effective local therapy of human cutaneous cancers but has no effect on distant untreated tumors. We addressed whether tumor-associated antigens released after ECT could induce an efficient systemic immunity when associated with an appropriate immunoadjuvant. We first studied the nature of the cellular recruitment and the expression of various toll-like receptors (TLRs) in tumors treated by ECT. We found that ECT induced a massive recruitment of CD11c and CD11b positive cells in the tumors and a strong increase of TLR9 expression. We then tested antitumor effects of the combination: ECT followed by TLR-9 ligands, CpG Oligodeoxynucleotides (CpG ODN), in three murine tumor models. We found that this combination triggered both potent local synergistic antitumor effects, on the ipsi-lateral ECT-treated tumor, and more interestingly, a systemic antitumor response on the contra-lateral untreated tumor, in the three models. The systemic protection was T-cell dependent as it was not observed in nude littermates. The combination induced tumor-specific T cell effectors in the tumor-draining lymph nodes and in the spleen which secreted significantly more gamma-interferon upon activation than with ECT or CpG ODN alone. Our data show that ECT and CpG ODN synergize and induce a significant increase of the local effect and a systemic T-dependent antitumor response. Such combination constitutes a potential innovative vaccination strategy using in situ tumor-associated antigens that could eventually be translated into the clinic.
