The Experts below are selected from a list of 2781 Experts worldwide ranked by ideXlab platform
Dong Kyu Jin - One of the best experts on this subject based on the ideXlab platform.
-
safety and efficacy of enzyme replacement therapy with idursulfase beta in children aged younger than 6 years with Hunter Syndrome
Molecular Genetics and Metabolism, 2015Co-Authors: Young Bae Sohn, Sung Yoon Cho, Jieun Lee, Yonghee Kwun, Rimm Huh, Dong Kyu JinAbstract:Idursulfase beta (Hunterase®) has been used for enzyme replacement therapy (ERT) of patients with mucopolysaccharidosis II (MPS II, Hunter Syndrome) aged 6 years or older since 2012 in Korea. The objective of this study was to evaluate the safety and efficacy of ERT with idursulfase beta in Hunter Syndrome children younger than 6 years. This study was a 52-week, single center, single arm, open-label clinical trial (NCT01645189). Idursulfase beta (0.5mg/kg/week) was administered intravenously for 52 weeks. The primary endpoint was safety assessed by adverse events (AEs). Secondary endpoints included vital signs, physical examination, ECG, laboratory tests, anti-idursulfase antibodies, and efficacy represented by changes in urinary glycosaminoglycan (GAG) at week 53 from baseline. In addition, growth indices and developmental milestones (Denver II test) were evaluated as exploratory variables. All six patients experienced at least one AE. A total of 109 AEs were reported. One patient experienced a serious AE (hospitalization due to gastroenteritis) that was considered not to be treatment related. One patient (16.7%) experienced infusion-related adverse drug reactions (ADRs), developing urticaria six times and a cough five times. There were no serious ADRs and no clinically significant changes in vital signs, physical exam, laboratory parameters, or ECG. Of the six patients, four (66.7%) showed anti-idursulfase antibodies and neutralizing antibodies on at least one occasion during the study. At week 53, urinary GAG was significantly reduced by -35.1±30.6mgGAG/g creatine from baseline (P=0.038). This study indicates that the safety and efficacy of idursulfase beta are similar to those reported in Hunter Syndrome patients aged 6 years or older.
-
improvement of cardiac function by short term enzyme replacement therapy in a murine model of cardiomyopathy associated with Hunter Syndrome evaluated by serial echocardiography with speckle tracking 2 d strain analysis
Molecular Genetics and Metabolism, 2014Co-Authors: Sangchol Lee, Dong Kyu Jin, Jieun Lee, Jungsun Kim, Eunseok Jeon, Young Hee Kwun, Mi Sun Chang, Yeon Joo Yook, Young Bae SohnAbstract:Abstract Cardiac systolic function is significantly decreased in a proportion of patients with Hunter Syndrome. This study was performed to evaluate the change in myocardial function associated with enzyme replacement therapy (ERT) in a mouse model of cardiomyopathy associated with Hunter Syndrome. Thirty 9-week-old iduronate-2-sulfatase (IDS) knockout mice received either intravenous injection of human recombinant IDS (ERT group, N = 15) or saline (control group, N = 15) for 5 weeks. Echocardiography was performed at baseline and after treatment. Echocardiographic parameters of left ventricular (LV) systolic function and 2-dimensional radial and circumferential strain were assessed. At follow-up, there was a significant increase in LV fractional shortening and radial and circumferential strain in the ERT group only. Notable myocardial fibrosis was observed in the control group only. In the murine model of Hunter Syndrome, ERT exerts beneficial effects on cardiac function, which can be evaluated by serial echocardiographic evaluation including 2-dimensional strain analysis.
-
High prevalence of carpal tunnel Syndrome in children with mucopolysaccharidosis type II (Hunter Syndrome).
American Journal of Medical Genetics Part A, 2011Co-Authors: Jeong-yi Kwon, Young Bae Sohn, Su Jin Kim, Sung Won Park, Se-hwa Kim, Sung Yoon Cho, Dong Kyu JinAbstract:Although carpal tunnel Syndrome (CTS) is the most common compressive neuropathy seen in the upper extremity of adults, it is rarely seen in children. Several reports have shown that mucopolysaccharidosis type II (Hunter Syndrome), a rare genetic disorder, is one of the causes of CTS in children. Usual symptoms of CTS are pain, weakness, and paresthesias in the hand and digits. However, the diagnosis of CTS in Hunter Syndrome is often delayed or unrecognized because of atypical symptoms and cognitive impairment. Here, we report the prevalence, clinical manifestation, and nerve conduction profiles of CTS in 45 Hunter Syndrome patients. The mean age of the study participants was 117.1 (74.9) months (range: 4-408 months); all patients were male. Forty-three (96.0%) of the 45 patients with Hunter Syndrome had CTS. Bilateral CTS was observed in all patients; 73 (82.0%) of the patients' hands had severe degree of CTS. Intriguingly, in contrast with other nerve velocities, decreases in forearm conduction velocities of the median nerve were observed in 28 (31.5%) of 89 hands with CTS. There was a significant difference in age (P < 0.001) between hands with normal, mild, moderate, and severe grades of CTS. The compound muscle action potential and sensory nerve action potential amplitudes of the median nerves decreased with age (CMAP, r = -0.526, P < 0.001; SNAP, r = -0.564, P < 0.001). Early recognition and intervention to ameliorate the symptoms of CTS are important in improving the quality of life of Hunter Syndrome patients.
-
Otologic manifestations of Hunter Syndrome and their relationship with speech development.
Audiology & neuro-otology, 2008Co-Authors: Yang-sun Cho, Soo Chan Chung, Son-a Chang, Joon Ho Kim, Tae Wook Kim, Dong Kyu JinAbstract:The excessive storage of mucopolysaccharide in Hunter Syndrome leads to various otologic manifestations. We interviewed 19 patients with Hunter Syndrome to assess their otologic problems, and conducted audiologic tests and temporal bone CT. Patients with the intermediate or severe form exhibited severe speech delay by more than 2 years (12/14 patients). However, in patients with the mild form (5/5), speech development was not much disturbed (2/5), although otoscopic findings were similar. The hearing threshold determined by the auditory brainstem response differed significantly between the mild and intermediate/severe forms (p < 0.05). Therefore, patients with the mild form may benefit from active otologic intervention such as VT insertion, amplification, and speech therapy.
-
mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated korean Hunter Syndrome patients identification of 13 novel mutations
Human Mutation, 2003Co-Authors: Chi Hwa Kim, Hye Zin Hwang, Seng Mi Song, Kyung Hoon Paik, Eun Kyung Kwon, Kwang Bin Moon, Jeong Hyeok Yoon, Cheol Kyu Han, Dong Kyu JinAbstract:Hunter Syndrome (Mucopolysaccharidosis type II, MPS2) is a n X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter Syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T , 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs , we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease. © 2003 Wiley-Liss, Inc.
Joseph Muenzer - One of the best experts on this subject based on the ideXlab platform.
-
the nature and impact of neurobehavioral symptoms in neuronopathic Hunter Syndrome
Molecular genetics and metabolism reports, 2020Co-Authors: Julie Eisengart, Kelly King, Elsa G Shapiro, Chester B Whitley, Joseph MuenzerAbstract:In neuronopathic Hunter Syndrome, neurobehavioral symptoms are known to be serious but have been incompletely described. While families face significant stress stemming from this complex and far-reaching array of symptoms, neither caregiver burden nor the neurobehavioral symptoms have been measured comprehensively. We delineated these neurobehavioral characteristics and their impact on the caregiver using multiple approaches. Methods: As part of the initial phase of developing a Hunter-specific behavioral assessment tool, we used multiple methods to obtain data on patient behaviors and caregiver burden, with the intention of drafting item sets for the tool. We utilized 1) caregiver descriptions from focus groups and individual interviews, 2) observations from video-recorded play of affected children, 3) descriptions from historic chart review, 4) consultation with patient advocacy groups and international experts, 5) reports from a caregiver advisory board, and 6) literature review. Results: Neurobehavioral symptoms were diverse and categorized as focus/attention, impulsivity/heightened activity, sensation seeking, emotional/behavioral function, social interaction, and sleep. A significant reported challenge was susceptibility to misinterpretation of some behaviors as defiant or aggressive, particularly if physical. Caregiver burden involved social isolation, exhaustion, stress, and financial and vocational strain. These new descriptions will aid in developing quantitative measures of change in neurobehavioral symptoms and family burden. These descriptions will be the foundation of a neurobehavioral rating scale, which is very much needed to aid in patient management and assess interventions for individuals with neuronopathic Hunter Syndrome.
-
the Hunter Syndrome functional outcomes for clinical understanding scale hs focus questionnaire item reduction and further validation
Quality of Life Research, 2014Co-Authors: Ingela Wiklund, Joseph Muenzer, Mireia Raluycallado, Wen Hung Chen, Juanzhi Fang, David A.h. WhitemanAbstract:Purpose The Hunter Syndrome-Functional Outcomes for Clinical Understanding Scale (HS-FOCUS) Questionnaire is a patient and parent-completed disease-specific instrument used in Hunter Syndrome (mucopolysaccharidosis II), a rare paediatric progressive multi-systemic lysosomal storage disease. The objective of this study was to shorten the number of items of the Questionnaire to reduce response burden while maintaining its content validity.
-
corrigendum long term open labeled extension study of idursulfase in the treatment of Hunter Syndrome
Genetics in Medicine, 2013Co-Authors: Joseph Muenzer, Paul Harmatz, Rick A Martin, Michael Beck, Roberto Giugliani, Christine M. Eng, J. E. Wraith, Uma Ramaswami, Ashok Vellodi, Maureen ClearyAbstract:CORRIGENDUM: Long-term, open-labeled extension study of idursulfase in the treatment of Hunter Syndrome
-
the role of enzyme replacement therapy in severe Hunter Syndrome an expert panel consensus
European Journal of Pediatrics, 2012Co-Authors: Joseph Muenzer, Olaf Bodamer, Simon A Jones, Barbara K. Burton, Roberto Giugliani, Maurizio Scarpa, Lorne A Clarke, Gudrun Schulze Frenking, Maria Veronica Munoz Rojas, Michael BeckAbstract:Intravenous enzyme replacement therapy (ERT) with idursulfase for Hunter Syndrome has not been demonstrated to and is not predicted to cross the blood–brain barrier. Nearly all published experience with ERT with idursulfase has therefore been in patients without cognitive impairment (attenuated phenotype). Little formal guidance is available on the issues surrounding ERT in cognitively impaired patients with the severe phenotype. An expert panel was therefore convened to provide guidance on these issues. The clinical experience of the panel with 66 patients suggests that somatic improvements (e.g., reduction in liver volume, increased mobility, and reduction in frequency of respiratory infections) may occur in most severe patients. Cognitive benefits have not been seen. It was agreed that, in general, severe patients are candidates for at least a 6–12-month trial of ERT, excluding patients who are severely neurologically impaired, those in a vegetative state, or those who have a condition that may lead to near-term death. It is imperative that the treating physician discuss the goals of treatment, methods of assessment of response, and criteria for discontinuation of treatment with the family before ERT is initiated. Conclusion: The decision to initiate ERT in severe Hunter Syndrome should be made by the physician and parents and must be based on realistic expectations of benefits and risks, with the understanding that ERT may be withdrawn in the absence of demonstrable benefits.
-
Multidisciplinary Management of Hunter Syndrome
Pediatrics, 2009Co-Authors: Joseph Muenzer, Paul Harmatz, Roberto Giugliani, Mathias Beck, Christine M. Eng, Maria L. Escolar, Nathalie Guffon, Wolfgang Kamin, Christoph Kampmann, S T KoseogluAbstract:Hunter Syndrome is a rare, X-linked disorder caused by a deficiency of the lysosomal enzyme iduronate-2-sulfatase. In the absence of sufficient enzyme activity, glycosaminoglycans accumulate in the lysosomes of many tissues and organs and contribute to the multisystem, progressive pathologies seen in Hunter Syndrome. The nervous, cardiovascular, respiratory, and musculoskeletal systems can be involved in individuals with Hunter Syndrome. Although the management of some clinical problems associated with the disease may seem routine, the management is typically complex and requires the physician to be aware of the special issues surrounding the patient with Hunter Syndrome, and a multidisciplinary approach should be taken. Subspecialties such as otorhinolaryngology, neurosurgery, orthopedics, cardiology, anesthesiology, pulmonology, and neurodevelopment will all have a role in management, as will specialty areas such as physiotherapy, audiology, and others. The important management topics are discussed in this review, and the use of enzyme-replacement therapy with recombinant human iduronate-2-sulfatase as a specific treatment for Hunter Syndrome is presented.
Michael Beck - One of the best experts on this subject based on the ideXlab platform.
-
corrigendum long term open labeled extension study of idursulfase in the treatment of Hunter Syndrome
Genetics in Medicine, 2013Co-Authors: Joseph Muenzer, Paul Harmatz, Rick A Martin, Michael Beck, Roberto Giugliani, Christine M. Eng, J. E. Wraith, Uma Ramaswami, Ashok Vellodi, Maureen ClearyAbstract:CORRIGENDUM: Long-term, open-labeled extension study of idursulfase in the treatment of Hunter Syndrome
-
the role of enzyme replacement therapy in severe Hunter Syndrome an expert panel consensus
European Journal of Pediatrics, 2012Co-Authors: Joseph Muenzer, Olaf Bodamer, Simon A Jones, Barbara K. Burton, Roberto Giugliani, Maurizio Scarpa, Lorne A Clarke, Gudrun Schulze Frenking, Maria Veronica Munoz Rojas, Michael BeckAbstract:Intravenous enzyme replacement therapy (ERT) with idursulfase for Hunter Syndrome has not been demonstrated to and is not predicted to cross the blood–brain barrier. Nearly all published experience with ERT with idursulfase has therefore been in patients without cognitive impairment (attenuated phenotype). Little formal guidance is available on the issues surrounding ERT in cognitively impaired patients with the severe phenotype. An expert panel was therefore convened to provide guidance on these issues. The clinical experience of the panel with 66 patients suggests that somatic improvements (e.g., reduction in liver volume, increased mobility, and reduction in frequency of respiratory infections) may occur in most severe patients. Cognitive benefits have not been seen. It was agreed that, in general, severe patients are candidates for at least a 6–12-month trial of ERT, excluding patients who are severely neurologically impaired, those in a vegetative state, or those who have a condition that may lead to near-term death. It is imperative that the treating physician discuss the goals of treatment, methods of assessment of response, and criteria for discontinuation of treatment with the family before ERT is initiated. Conclusion: The decision to initiate ERT in severe Hunter Syndrome should be made by the physician and parents and must be based on realistic expectations of benefits and risks, with the understanding that ERT may be withdrawn in the absence of demonstrable benefits.
-
mucopolysaccharidosis type ii Hunter Syndrome clinical picture and treatment
Current Pharmaceutical Biotechnology, 2011Co-Authors: Michael BeckAbstract:Mucopolysaccharidosis (MPS) type II (Hunter Syndrome, OMIM 309900) is an X-linked lysosomal storage disorder caused by a deficiency of the lysosomal enzyme iduronate-2-sulfatase (IDS). Major clinical manifestations include joint contractures, obstructive and restrictive airway disease, cardiac disease, skeletal deformities and often mental retardation. As with all the MPS disorders, mucopolysaccharidosis type II is a clinically heterogeneous disease in terms of the extent and rate of progression of organ impairment in affected individuals. Common causes of death, which usually occurs within the second decade of life, are obstructive airway disease and cardiac failure due to valvular dysfunction, pulmonary hypertension and myocardial disease. Patients with the more attenuated (so-called adult) form usually have a normal intelligence, but often have many complaints such as progressive loss of vision due to retinal dysfunction, spastic paresis due to myelon compression at the cranio-cerevical region, severe hip disease and cardiac complications. Clinical investigations that have been performed in the last years in a great number of patients have shown that many of these complications are still underdiagnosed and untreated. Until recently, no specific treatment was available for the affected patients; management mainly consisted of supportive care and treatment of complications. Enzyme replacement therapy with recombinant iduronate-2-sulphatase (idursulfase), however, has now been introduced. And it could be demonstrated that weekly intravenous infusions of idursulfase is able to improve many of the symptoms and signs of Hunter Syndrome. This review will present the efficacy and safety data of the enzyme preparation and discuss benefits and limitations of this new therapeutic option.
-
Prevalence and characterization of cardiac involvement in Hunter Syndrome.
The Journal of pediatrics, 2011Co-Authors: Christoph Kampmann, Michael Beck, Isabelle Morin, James P. LoehrAbstract:Objectives To assess the prevalence of cardiovascular signs and symptoms in a large group of patients with Hunter Syndrome, an X-linked metabolic disorder caused by a deficiency of the lysosomal enzyme iduronate-2-sulfatase. Study design The Hunter Outcome Survey was established to characterize the natural history of Hunter Syndrome and to assess the response to enzyme replacement therapy. Echocardiographic and electrocardiographic examination results were available for 102 patients who were enzyme replacement therapy-naive in the Hunter Outcome Survey (median age at examination, approximately 8 years) as of Jan 23, 2009. Results The most common cardiovascular finding was valve disease, which was present in 63% of patients. Left ventricular hypertrophy (defined as left ventricular mass indexed to height 2.7 ≥50 g/m 2.7 ) was found in 48% of patients Conclusions Treating physicians should be aware of the early emergence of cardiovascular manifestations in patients with Hunter Syndrome so that appropriate treatment can be initiated.
-
recognition and diagnosis of mucopolysaccharidosis ii Hunter Syndrome
Pediatrics, 2008Co-Authors: Rick A Martin, Paul Harmatz, Veronica Munoz, Michael Beck, Roberto Giugliani, Joseph MuenzerAbstract:Mucopolysaccharidosis II, also known as Hunter Syndrome, is a rare, X-linked disorder caused by a deficiency of the lysosomal enzyme iduronate-2-sulfatase, which catalyzes a step in the catabolism of glycosaminoglycans. In patients with mucopolysaccharidosis II, glycosaminoglycans accumulate within tissues and organs, contributing to the signs and symptoms of the disease. Mucopolysaccharidosis II affects multiple organs and physiologic systems and has a variable age of onset and variable rate of progression. Common presenting features include excess urinary glycosaminoglycan excretion, facial dysmorphism, organomegaly, joint stiffness and contractures, pulmonary dysfunction, myocardial enlargement and valvular dysfunction, and neurologic involvement. In patients with neurologic involvement, intelligence is impaired, and death usually occurs in the second decade of life, whereas those patients with minimal or no neurologic involvement may survive into adulthood with normal intellectual development. Enzyme replacement therapy has emerged as a new treatment for mucopolysaccharidosis disorders, including Hunter Syndrome. The purpose of this report is to provide a concise review of mucopolysaccharidosis II for practitioners with the hope that such information will help identify affected boys earlier in the course of their disease.
Roberto Giugliani - One of the best experts on this subject based on the ideXlab platform.
-
guidelines for diagnosis and treatment of Hunter Syndrome for clinicians in latin america
Genetics and Molecular Biology, 2014Co-Authors: Roberto Giugliani, Martha Solano Villarreal, Araceli Arellano C Valdez, Antonieta Mahfoud Hawilou, Norberto Guelbert, Luz Norela Correa Garzon, Ana Maria Martins, Angelina Xavier Acosta, Juan Francisco Cabello, Aida LemesAbstract:This review aims to provide clinicians in Latin America with the most current information on the clinical aspects, diagnosis, and management of Hunter Syndrome, a serious and progressive disease for which specific treatment is available. Hunter Syndrome is a genetic disorder where iduronate-2-sulfatase (I2S), an enzyme that degrades glycosaminoglycans, is absent or deficient. Clinical manifestations vary widely in severity and involve multiple organs and tissues. An attenuated and a severe phenotype are recognized depending on the degree of cognitive impairment. Early diagnosis is vital for disease management. Clinical signs common to children with Hunter Syndrome include inguinal hernia, frequent ear and respiratory infections, facial dysmorphisms, macrocephaly, bone dysplasia, short stature, sleep apnea, and behavior problems. Diagnosis is based on screening urinary glycosaminoglycans and confirmation by measuring I2S activity and analyzing I2S gene mutations. Idursulfase (recombinant I2S) (Elaprase®, Shire) enzyme replacement therapy (ERT), designed to address the underlying enzyme deficiency, is approved treatment and improves walking capacity and respiratory function, and reduces spleen and liver size and urinary glycosaminoglycan levels. Additional measures, responding to the multi-organ manifestations, such as abdominal/inguinal hernia repair, carpal tunnel surgery, and cardiac valve replacement, should also be considered. Investigational treatment options such as intrathecal ERT are active areas of research, and bone marrow transplantation is in clinical practice. Communication among care providers, social workers, patients and families is essential to inform and guide their decisions, establish realistic expectations, and assess patients’ responses.
-
corrigendum long term open labeled extension study of idursulfase in the treatment of Hunter Syndrome
Genetics in Medicine, 2013Co-Authors: Joseph Muenzer, Paul Harmatz, Rick A Martin, Michael Beck, Roberto Giugliani, Christine M. Eng, J. E. Wraith, Uma Ramaswami, Ashok Vellodi, Maureen ClearyAbstract:CORRIGENDUM: Long-term, open-labeled extension study of idursulfase in the treatment of Hunter Syndrome
-
the role of enzyme replacement therapy in severe Hunter Syndrome an expert panel consensus
European Journal of Pediatrics, 2012Co-Authors: Joseph Muenzer, Olaf Bodamer, Simon A Jones, Barbara K. Burton, Roberto Giugliani, Maurizio Scarpa, Lorne A Clarke, Gudrun Schulze Frenking, Maria Veronica Munoz Rojas, Michael BeckAbstract:Intravenous enzyme replacement therapy (ERT) with idursulfase for Hunter Syndrome has not been demonstrated to and is not predicted to cross the blood–brain barrier. Nearly all published experience with ERT with idursulfase has therefore been in patients without cognitive impairment (attenuated phenotype). Little formal guidance is available on the issues surrounding ERT in cognitively impaired patients with the severe phenotype. An expert panel was therefore convened to provide guidance on these issues. The clinical experience of the panel with 66 patients suggests that somatic improvements (e.g., reduction in liver volume, increased mobility, and reduction in frequency of respiratory infections) may occur in most severe patients. Cognitive benefits have not been seen. It was agreed that, in general, severe patients are candidates for at least a 6–12-month trial of ERT, excluding patients who are severely neurologically impaired, those in a vegetative state, or those who have a condition that may lead to near-term death. It is imperative that the treating physician discuss the goals of treatment, methods of assessment of response, and criteria for discontinuation of treatment with the family before ERT is initiated. Conclusion: The decision to initiate ERT in severe Hunter Syndrome should be made by the physician and parents and must be based on realistic expectations of benefits and risks, with the understanding that ERT may be withdrawn in the absence of demonstrable benefits.
-
importance of surgical history in diagnosing mucopolysaccharidosis type ii Hunter Syndrome data from the Hunter outcome survey
Genetics in Medicine, 2010Co-Authors: Nancy J. Mendelsohn, Paul Harmatz, Olaf Bodamer, Christina Lampe, Gunilla Malm, Simon A Jones, Barbara K. Burton, Robert D. Steiner, Roberto Giugliani, Rossella PariniAbstract:Importance of surgical history in diagnosing mucopolysaccharidosis type II (Hunter Syndrome): Data from the Hunter Outcome Survey
-
Multidisciplinary Management of Hunter Syndrome
Pediatrics, 2009Co-Authors: Joseph Muenzer, Paul Harmatz, Roberto Giugliani, Mathias Beck, Christine M. Eng, Maria L. Escolar, Nathalie Guffon, Wolfgang Kamin, Christoph Kampmann, S T KoseogluAbstract:Hunter Syndrome is a rare, X-linked disorder caused by a deficiency of the lysosomal enzyme iduronate-2-sulfatase. In the absence of sufficient enzyme activity, glycosaminoglycans accumulate in the lysosomes of many tissues and organs and contribute to the multisystem, progressive pathologies seen in Hunter Syndrome. The nervous, cardiovascular, respiratory, and musculoskeletal systems can be involved in individuals with Hunter Syndrome. Although the management of some clinical problems associated with the disease may seem routine, the management is typically complex and requires the physician to be aware of the special issues surrounding the patient with Hunter Syndrome, and a multidisciplinary approach should be taken. Subspecialties such as otorhinolaryngology, neurosurgery, orthopedics, cardiology, anesthesiology, pulmonology, and neurodevelopment will all have a role in management, as will specialty areas such as physiotherapy, audiology, and others. The important management topics are discussed in this review, and the use of enzyme-replacement therapy with recombinant human iduronate-2-sulfatase as a specific treatment for Hunter Syndrome is presented.
Ulf Pettersson - One of the best experts on this subject based on the ideXlab platform.
-
double strand breaks may initiate the inversion mutation causing the Hunter Syndrome
Human Molecular Genetics, 1997Co-Authors: Kristina Lagerstedt, Stanislav L Karsten, Brittmarie Carlberg, W J Kleijer, Tonne Tonnesen, Ulf Pettersson, Marielouise BondesonAbstract:We have previously shown that patients with the Hunter Syndrome frequently have suffered from a recombination event between the IDS gene and its putative pseudogene, IDS-2, resulting in an inversion of the intervening DNA. The inversion, which might be the consequence of an intrachromosomal mispairing, is caused by homologous recombination between sequences located in intron 7 of the IDS gene and sequences located distal of exon 3 in IDS-2. In order to gain insight into the mechanisms causing the inversion, we have isolated both inversion junctions in six unrelated patients. DNA sequence analysis of the junctions showed that all recombinations have taken place within a 1 kb region where the sequence identity is >98%. An interesting finding was the identification of regions with alternating IDS gene and IDS-2 sequences present at one inversion junction, suggesting that the recombination event has been initiated by a double-strand break in intron 7 of the IDS gene. The results from this study suggest that homologous recombination in man could be explained by mechanisms similar to those described for Saccharomyces cerevisiae. The results also have practical implications for diagnosis of patients with the Hunter Syndrome.
-
molecular and phenotypic variation in patients with severe Hunter Syndrome
Human Molecular Genetics, 1997Co-Authors: Kirsten M Timms, Ulf Pettersson, Marielouise Bondeson, Ali M Ansarilari, Kristina Lagersted, Donna M Muzny, Shannon Duganrocha, David L Nelson, Richard A GibbsAbstract:Severe Hunter Syndrome is a fatal X-linked lysosomal storage disorder caused by iduronate-2-sulphatase (IDS) deficiency. Patients with complete deletion of the IDS locus often have atypical phenotypes including ptosis, obstructive sleep apnoea, and the occurrence of seizures. We have used genomic DNA sequencing to identify several new genes in the IDS region. DNA deletion patients with atypical symptoms have been analysed to determine whether these atypical symptoms could be due to involvement of these other loci. The occurrence of seizures in two individuals correlated with a deletion extending proximal of IDS, up to and including part of the FMR2 locus. Other (non-seizure) symptoms were associated with distal deletions. In addition, a group of patients with no variant symptoms, and a characteristic rearrangement involving a recombination between the IDS gene and an adjacent IDS pseudogene (IDSv|/), showed normal expression of loci distal to IDS. Together, these results identify FMR2 as a candidate gene for seizures, when mutated along with IDS.
-
Presence of an IDS-Related Locus (IDS2) in Xq28 Complicates the Mutational Analysis of Hunter Syndrome
European Journal of Human Genetics, 1995Co-Authors: Marielouise Bondeson, Brittmarie Carlberg, Helena Malmgren, Niklas Dahl, Ulf PetterssonAbstract:A deficiency of the enzyme iduronate-2-sulfatase (IDS) is the cause of Hunter Syndrome (mucopolysaccharidosis type II). Here, we report a study of the human IDS locus at Xq28. An unexpected finding was an IDS-related region (IDS2) which is located on the telomeric side of the IDS gene within 80 kb. We have identified sequences in this locus that are homologous to exons 2 and 3 as well as sequences homologous to introns 2, 3 and 7 of the IDS gene. The exon 3 sequences in the IDS gene and in the IDS2 locus showed 100% identity. The overall identities of the other identified regions were 96%. A locus for DXS466 was also found to be located close to IDS2. The existence of the IDS2 locus complicates the diagnosis of mutations in genomic DNA from patients with Hunter Syndrome. However, information about the IDS2 locus makes it possible to analyze the IDS gene and the IDS2 locus separately after PCR amplification.
-
inversion of the ids gene resulting from recombination with ids related sequences is a common cause of the Hunter Syndrome
Human Molecular Genetics, 1995Co-Authors: Marielouise Bondeson, Brittmarie Carlberg, W J Kleijer, Tonne Tonnesen, Helena Malmgren, Niklas Dahl, Ulf PetterssonAbstract:We have recently described the identification of a second IDS locus (IDS-2) located within 90 kb telomeric of the IDS gene (Bondeson et al. submitted). Here, we show that this region is involved in a recombination event with the IDS gene in about 13% of patients with the Hunter Syndrome. Analysis of the resulting rearrangement at the molecular level showed that these patients have suffered a recombination event that results in a disruption of the IDS gene in intron 7 with an inversion of the intervening DNA. Interestingly, all of the six cases with a similar type of rearrangement showed recombination between intron 7 of the IDS gene and sequences close to exon 3 at the IDS-2 locus implying that these regions are hot spots for recombination. Analysis by nucleotide sequencing showed that the inversion is caused by recombination between homologous sequences present in the IDS gene and the IDS-2 locus. No detectable deletions or insertions were observed as a result of the recombination event. The results in this study have practical implications for diagnosis of the Hunter Syndrome.
