The Experts below are selected from a list of 276 Experts worldwide ranked by ideXlab platform
Peter B Dervan - One of the best experts on this subject based on the ideXlab platform.
-
phosphorothioate oligonucleotide directed triple helix formation
Biochemistry, 1994Co-Authors: Joseph G Hacia, Barbara J Wold, Peter B DervanAbstract:Phosphorothioate Oligodeoxyribonucleotides were tested for their ability to recognize double-helical DNA in two distinct triple helix motifs. Purine-rich oligonucleotides containing a diastereomeric mixture of phosphorothioate or stereoregular (all RP) phosphorothioate linkages are shown to form triple-helical complexes with affinities similar to those of the corresponding natural phosphodiester oligonucleotides. In contrast, pyrimidine-rich phosphorothioate oligonucleotides containing a mixture of diastereomeric or stereoregular (all RP) linkages do not bind to double-helical DNA with measurable affinity. These observations have implications for triple helix structure and for biological applications.
-
thermodynamics of Oligodeoxyribonucleotide directed triple helix formation an analysis using quantitative affinity cleavage titration
Journal of the American Chemical Society, 1992Co-Authors: Scott F Singleton, Peter B DervanAbstract:The free energy for Oligodeoxyribonucleotide-directed triple helix formation at a single site on a DNA plasmid fragment has been analyzed using quantitative affinity cleavage titration. Measurement of the amount of site-specific cleavage of a 339-bp radiolabeled DNA duplex produced at 24-degrees-C (100 mM Na+, 1 mM spermine-4HCl, 50 mM Tris-acetate, pH 7.0) over a concentration change of four orders of magnitude for Oligodeoxyribonucleotide-EDTA.Fe 1.Fe, (5'-T*TTTTCTCTCTCTCT-3') yields an equilibrium binding constant, K(T) = 3.7 +/- 1.1 x 10(6) M-1 (DELTA-G(T) = -9.0 +/- 0.2 kcal.mol-1). Quantitative affinity cleavage titration affords association constants that are identical within experimental uncertainty with those obtained from quantitative DNase I footprint titration of the same oligonucleotide with and without EDTA.In (1.In and 6, respectively). Removal of one thymidine and one cytidine residue from the 3' end of 1.Fe reduces the free energy of binding by 0.5 kcal.mol-1, and removal of two thymidine and two cytidine residues from its 3' terminus decreases the binding free energy by 1.1 kcal.mol-1 at pH 7.0. Single internal base triplet mismatches result in a destabilization of the local triple-helical structure by 2.5-3.0 kcal.mol-1. Quantitative affinity cleavage titration is a general method which should allow for the measurement of equilibrium constants for the association of many DNA-binding molecules to single sites on relatively large DNA under a broad range of solution conditions.
Serge L Beaucage - One of the best experts on this subject based on the ideXlab platform.
-
the 4 oxopentyl group as a labile phosphate thiophosphate protecting group for synthetic Oligodeoxyribonucleotides
Tetrahedron Letters, 2001Co-Authors: Andrzej Wilk, Marcin K Chmielewski, Andrzej Grajkowski, Lawrence R Phillips, Serge L BeaucageAbstract:Abstract An efficient and economical method for the solid-phase synthesis of Oligodeoxyribonucleotides and their phosphorothioate analogues is described. The method entails the use of the 4-oxopentyl group for phosphate/thiophosphate protection. Post-synthesis removal of the protecting group is easily and rapidly achieved under mild conditions at ambient temperature using either pressurized gaseous amines or concentrated ammonium hydroxide.
G S Srivatsa - One of the best experts on this subject based on the ideXlab platform.
-
analysis of internal n 1 mer deletion sequences in synthetic Oligodeoxyribonucleotides by hybridization to an immobilized probe array
Nucleic Acids Research, 1999Co-Authors: Danhua Chen, Zhengming Yan, Douglas L Cole, G S SrivatsaAbstract:The purity of a drug substance can influence its toxicity and potency, so impurities must be specifically determined. In the case of synthetic Oligodeoxyribonucleotide drugs, however, product complexity makes complete impurity speciation difficult. The goal of the present work was to develop a new analytical method for speciation of individual internal (n-1)mer impurities arising from formal nucleotide deletion in synthetic Oligodeoxyribonucleotides. A complete series of Oligodeoxyribonucleotide probes were designed, each complementary to an (n-1)mer deletion sequence of the drug in question. Glass plates were used as a solid support for individually immobilizing the entire probe array. The total mixture of internal (n-1) length impurities was isolated from a synthetic Oligodeoxyribonucleotide by PAGE and labeled with 35S. Under stringently optimized conditions, only the perfectly sequence-matched Oligodeoxyribonucleotide hybridized to each probe, while all other deletion sequences were removed by washing with buffer. The 35S signal intensity of the bound Oligodeoxyribonucleotide was proportional to the concentration of each (n-1)mer deletion sequence in the analyte solution. This method has been applied to a number of synthetic phosphorothioate oligodeoxy-ribonucleotide lots and shown to be reliable for speciation and relative quantitation of the internal (n -1)mer deletion sequences present.
Yogesh S Sanghvi - One of the best experts on this subject based on the ideXlab platform.
-
further optimization of detritylation in solid phase Oligodeoxyribonucleotide synthesis
ChemInform, 2011Co-Authors: Kha Tram, Yogesh S Sanghvi, Hongbin YanAbstract:Optimized reaction conditions for the removal of dimethoxytrityl, pixyl, and dimethylpixyl protecting groups in compounds (I) are elaborated.
-
further optimization of detritylation in solid phase Oligodeoxyribonucleotide synthesis
Nucleosides Nucleotides & Nucleic Acids, 2011Co-Authors: Kha Tram, Yogesh S Sanghvi, Hongbin YanAbstract:Various conditions for optimum detritylation (i.e., the removal of 5′-O-trityl protecting groups) during solid-phase synthesis of Oligodeoxyribonucleotides were investigated. Di- and tri-chloroacetic acids of variable concentrations were used to study the removal of the 4,4′-dimethoxytrityl (DMTr) group. It was found that the DMTr group could be completely removed under much milder acidic conditions than what are currently used for automated solid-phase synthesis. The 2,7-dimethylpixyl (DMPx) is proposed as an alternative and more readily removable group for the protection of the 5′-OH functions both in solid- and solution-phase synthesis. The improved detritylation conditions are expected to minimize the waste and offer a protocol for incorporation of acid sensitive building-blocks in oligonucleotides.
-
multiple Oligodeoxyribonucleotide syntheses on a reusable solid phase cpg support via the hydroquinone o o diacetic acid q linker linker arm
Nucleic Acids Research, 1999Co-Authors: Richard T Pon, Zhiqiang Guo, Yogesh S SanghviAbstract:A strategy for Oligodeoxyribonucleotide synthesis on a reusable CPG solid-phase support, derivatized with hydroxyl groups instead of amino groups, has been developed. Ester linkages, through a base labile hydroquinone-O,O4-diacetic acid (Q-Linker) linker arm, were used to couple the first nucleoside to the hydroxyl groups on the support. This coupling was rapidly accomplished (10 min) using O-benzotriazol1-yl-N,N,N4,N4-tetramethyluronium hexafluorophosphate (HBTU) and 1-hydroxybenzotriazole as the activating reagents. Oligodeoxyribonucleotide synthesis was performed using existing procedures and reagents, except a more labile capping reagent, such as chloroacetic anhydride, methoxyacetic anhydride or t-butylphenoxyacetic anhydride, was used instead of acetic anhydride. After each Oligodeoxyribonucleotide synthesis, the product was cleaved from the support with ammonium hydroxide (3 min) and deprotected as usual. Residual linker arms or capping groups were removed by treatment with ammonium hydroxide/ methylamine reagent and the regenerated support was capable of reuse. Up to six different Oligodeoxyribonucleotide syntheses or up to 25 cycles of nucleoside derivatization and cleavage were consecutively performed on the reusable support. This method may provide a significant cost advantage over conventional single-use solid supports currently used for the manufacture of antisense Oligodeoxyribonucleotides.
Michael P Stone - One of the best experts on this subject based on the ideXlab platform.
-
site specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of Oligodeoxyribonucleotides
Nucleic Acids Research, 1998Co-Authors: Wendelyn R Jones, Michael P StoneAbstract:The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an Oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The Oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The Oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two Oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.
