The Experts below are selected from a list of 7134 Experts worldwide ranked by ideXlab platform

Serge L. Beaucage - One of the best experts on this subject based on the ideXlab platform.

  • thermolytic 4 methylthio 1 butyl group for phosphate thiophosphate protection in solid phase synthesis of dna oligonucleotides
    Journal of Organic Chemistry, 2004
    Co-Authors: Jacek Cieślak, Andrzej Grajkowski, And Victor Livengood, Serge L. Beaucage
    Abstract:

    The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a “heat-driven” process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a−d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 °C in an aqueous buffer under neutral conditions or within 2 h at 55 °C in concentrated NH4OH. The Deprotection Reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides an...

  • the 3 n tert butylcarboxamido 1 propyl group as an attractive phosphate thiophosphate protecting group for solid phase oligodeoxyribonucleotide synthesis
    Journal of Organic Chemistry, 2002
    Co-Authors: Andrzej Wilk, Marcin K. Chmielewski, Andrzej Grajkowski, Lawrence R. Phillips, Serge L. Beaucage
    Abstract:

    Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The Deprotection Reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification Reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

  • the 4 n methyl n 2 2 2 trifluoroacetyl amino butyl group as an alternative to the 2 cyanoethyl group for phosphate protection in the synthesis of oligodeoxyribonucleotides
    Journal of Organic Chemistry, 1999
    Co-Authors: Andrzej Wilk, Andrzej Grajkowski, And Lawrence R Phillips, Serge L. Beaucage
    Abstract:

    The 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl group for phosphate protection in the synthesis of oligodeoxyribonucleotides has been developed to completely prevent nucleobase alkylation by acrylonitrile that could potentially occur upon Deprotection of the traditional 2-cyanoethyl phosphate protecting group. The properties of this new phosphate protecting group were evaluated using the model phosphotriester 9. The mechanism of phosphate Deprotection was studied by treating 9 with concentrated NH4OH. NMR analysis of the Deprotection Reaction demonstrated that cleavage of the N-trifluoroacetyl group is rate-limiting. The resulting phosphotriester intermediate 13 was also shown to undergo rapid cyclodeesterification to produce O,O-diethyl phosphate 15 and N-methylpyrrolidine 16 (Scheme 2). Given the facile removal of the 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl phosphate protecting group under mild basic conditions, its utilization in oligonucleotide synthesis began with the preparation of the...

Andrzej Grajkowski - One of the best experts on this subject based on the ideXlab platform.

  • thermolytic 4 methylthio 1 butyl group for phosphate thiophosphate protection in solid phase synthesis of dna oligonucleotides
    Journal of Organic Chemistry, 2004
    Co-Authors: Jacek Cieślak, Andrzej Grajkowski, And Victor Livengood, Serge L. Beaucage
    Abstract:

    The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a “heat-driven” process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a−d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 °C in an aqueous buffer under neutral conditions or within 2 h at 55 °C in concentrated NH4OH. The Deprotection Reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides an...

  • the 3 n tert butylcarboxamido 1 propyl group as an attractive phosphate thiophosphate protecting group for solid phase oligodeoxyribonucleotide synthesis
    Journal of Organic Chemistry, 2002
    Co-Authors: Andrzej Wilk, Marcin K. Chmielewski, Andrzej Grajkowski, Lawrence R. Phillips, Serge L. Beaucage
    Abstract:

    Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The Deprotection Reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification Reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

  • the 4 n methyl n 2 2 2 trifluoroacetyl amino butyl group as an alternative to the 2 cyanoethyl group for phosphate protection in the synthesis of oligodeoxyribonucleotides
    Journal of Organic Chemistry, 1999
    Co-Authors: Andrzej Wilk, Andrzej Grajkowski, And Lawrence R Phillips, Serge L. Beaucage
    Abstract:

    The 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl group for phosphate protection in the synthesis of oligodeoxyribonucleotides has been developed to completely prevent nucleobase alkylation by acrylonitrile that could potentially occur upon Deprotection of the traditional 2-cyanoethyl phosphate protecting group. The properties of this new phosphate protecting group were evaluated using the model phosphotriester 9. The mechanism of phosphate Deprotection was studied by treating 9 with concentrated NH4OH. NMR analysis of the Deprotection Reaction demonstrated that cleavage of the N-trifluoroacetyl group is rate-limiting. The resulting phosphotriester intermediate 13 was also shown to undergo rapid cyclodeesterification to produce O,O-diethyl phosphate 15 and N-methylpyrrolidine 16 (Scheme 2). Given the facile removal of the 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl phosphate protecting group under mild basic conditions, its utilization in oligonucleotide synthesis began with the preparation of the...

Andrzej Wilk - One of the best experts on this subject based on the ideXlab platform.

  • the 3 n tert butylcarboxamido 1 propyl group as an attractive phosphate thiophosphate protecting group for solid phase oligodeoxyribonucleotide synthesis
    Journal of Organic Chemistry, 2002
    Co-Authors: Andrzej Wilk, Marcin K. Chmielewski, Andrzej Grajkowski, Lawrence R. Phillips, Serge L. Beaucage
    Abstract:

    Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The Deprotection Reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification Reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

  • the 4 n methyl n 2 2 2 trifluoroacetyl amino butyl group as an alternative to the 2 cyanoethyl group for phosphate protection in the synthesis of oligodeoxyribonucleotides
    Journal of Organic Chemistry, 1999
    Co-Authors: Andrzej Wilk, Andrzej Grajkowski, And Lawrence R Phillips, Serge L. Beaucage
    Abstract:

    The 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl group for phosphate protection in the synthesis of oligodeoxyribonucleotides has been developed to completely prevent nucleobase alkylation by acrylonitrile that could potentially occur upon Deprotection of the traditional 2-cyanoethyl phosphate protecting group. The properties of this new phosphate protecting group were evaluated using the model phosphotriester 9. The mechanism of phosphate Deprotection was studied by treating 9 with concentrated NH4OH. NMR analysis of the Deprotection Reaction demonstrated that cleavage of the N-trifluoroacetyl group is rate-limiting. The resulting phosphotriester intermediate 13 was also shown to undergo rapid cyclodeesterification to produce O,O-diethyl phosphate 15 and N-methylpyrrolidine 16 (Scheme 2). Given the facile removal of the 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl phosphate protecting group under mild basic conditions, its utilization in oligonucleotide synthesis began with the preparation of the...

Karen Turnquest - One of the best experts on this subject based on the ideXlab platform.

  • influence of base additives on the Reaction diffusion front of model chemically amplified photoresists
    Journal of Vacuum Science & Technology B, 2007
    Co-Authors: Bryan D Vogt, Shuhui Kang, Vivek M Prabhu, Ashwin Rao, Eric K Lin, Sushil K Satija, Karen Turnquest
    Abstract:

    The effects of amine base quencher on the photoacid catalyzed Deprotection Reaction-diffusion front in model photoresists were measured by combination of neutron reflectivity and Fourier transform infrared spectroscopy. Modulation in the location of the base with respect to the diffusing photoacid catalyst changes the spatial Reaction extent and illuminates the complex role of the base on the shape of the Reaction-diffusion front. Despite similar total extents of Reaction, a comparison between uniform base and model photodegradable base distributions demonstrates distinct Reaction time and base concentration effects on the Deprotection profile shape. These differences arise from the modification of the initial Deprotection extent due to both the neutralization of the photoacid and the influence of the changing photoresist composition on the Reaction-diffusion process. The use of the model photodegradable base results in a sharper front due to these effects. Lastly, aqueous hydroxide development of these l...

  • measurements of the Reaction diffusion front of model chemically amplified photoresists with varying photoacid size
    Macromolecules, 2006
    Co-Authors: Bryan D Vogt, Shuhui Kang, Vivek M Prabhu, Eric K Lin, Sushil K Satija, Karen Turnquest
    Abstract:

    Neutron reflectivity and Fourier transform infrared spectroscopy measurements are used to profile the Deprotection Reaction−diffusion front with nanometer resolution in a model photoresist polymer using three perfluoroalkane-based photoacid generators (PAG) with varying chain lengths. As expected, the spatial extent of the Deprotection Reaction front increases with decreasing PAG size. Although the total extent of Deprotection increases with increasing postexposure bake time for each PAG, the Reaction−diffusion of Deprotection does not propagate continuously into the photoresist polymer. The form of the Deprotection Reaction front changes because the diffusion process is affected by the changing polymer composition. The data are well described by a Reaction−diffusion model that includes a simple acid-trapping term and does not require a varying PAG diffusivity. This high-resolution profiling, together with modeling, illustrates details of the coupled diffusion and Deprotection Reaction processes that affe...

Qian Peng - One of the best experts on this subject based on the ideXlab platform.