The Experts below are selected from a list of 735 Experts worldwide ranked by ideXlab platform
S. W. Scott - One of the best experts on this subject based on the ideXlab platform.
-
genomic sequences of blackberry chlorotic ringspot virus and strawberry necrotic shock virus and the phylogeny of viruses in subgroup 1 of the genus Ilarvirus
Archives of Virology, 2010Co-Authors: Ioannis E Tzanetakis, Robert R Martin, S. W. ScottAbstract:Three members of subgroup 1 of the genus Ilarvirus: blackberry chlorotic ringspot (BCRV), strawberry necrotic shock (SNSV), and tobacco streak viruses (TSV), may infect Rubus and Fragaria species. All cause symptoms similar to those previously attributed to infection by TSV alone. Although similarities exist among the genomic sequences of the three, phylogenetic analysis shows them to be distinct viruses. These viruses and Parietaria mottle virus, the other currently accepted member of subgroup 1, appear to have evolved from a common ancestral virus, share conserved motifs in the products of the genomic RNAs, and constitute a distinct subgroup within the genus.
-
purification and properties of blackberry chlorotic ringspot a new virus species in subgroup 1 of the genus Ilarvirus found naturally infecting blackberry in the uk
Annals of Applied Biology, 2006Co-Authors: A. T. Jones, M T Zimmerman, Wendy J Mcgavin, V Gepp, S. W. ScottAbstract:A mechanically transmissible virus was isolated from Bedford Giant blackberry plants showing chlorotic mottling and ringspot symptoms growing in Scotland. It infected several herbaceous test plants, many of them symptomlessly. This virus was also transmitted to several Rubus species and cultivars by graft inoculation with scions from the field-infected Bedford Giant plant. Most grafted plants were infected symptomlessly, but Himalaya Giant blackberry and the hybrid berry Tayberry developed symptoms similar to those in the infected Bedford Giant plant. In the sap of infected Chenopodium quinoa, the virus lost infectivity when diluted 10 -4 but not 10 -3 , after 6 h and 48 h when kept at 20°C and 4°C, respectively, but was infective for more than 8 days when kept at -15°C. Preparations of purified virus from infected C. quinoa or spinach sedimented as three major nucleoprotein components and consisted of quasi-isometric particles that varied in size from 24 to 32 nm in diameter and that were not penetrated by negative stain. Such virus particle preparations contained a major polypeptide of ca 28 kDa and three single-stranded RNA species of estimated size 3.2, 2.8 and 2.1 kb. The complete sequence of the largest RNA (RNA 1, 3478 nt) and the partial sequence of the other RNAs (1863 and 2102 nt long, respectively) were determined and compared with sequences in databases. These findings, together with the biological and biochemical properties of this virus, indicate that it should be regarded as a distinct species in subgroup 1 of the genus Ilarvirus even though it was serologically unrelated to existing members of this subgroup. The virus showed a very distant serological relationship with prune dwarf virus (PDV) but differed significantly from it in the amino acid sequence of its coat protein, experimental host range and symptomatology and was unrelated to PDV at the molecular level. The virus, tentatively named blackberry chlorotic ringspot virus, is therefore a newly described virus and the first Ilarvirus found naturally infecting Rubus in the UK.
-
viruses in subgroup 2 of the genus Ilarvirus share both serological relationships and characteristics at the molecular level
Archives of Virology, 2003Co-Authors: S. W. Scott, M T Zimmerman, X GeAbstract:Sequence data have been determined for 5 members of subgroup 2 of the genus Ilarvirus. These data support the known serological relationships among accepted members of this group and indicate that the Ilarvirus Hydrangea mosaic virus (HdMV) is an isolate of Elm mottle virus (EMoV). The close relationships between members of this subgroup, exhibited through the coat proteins coded on RNA 3, extend to the other genomic molecules. Primers designed from the sequences of RNA 1 and RNA 2 of EMoV amplified fragments from all other subgroup 2 viruses but not from other Ilarviruses. Although closely related, members of this subgroup occur naturally in distinctly different host species. The possible origins of the viruses are discussed in relation to similarities among the genomic molecules, in particular RNA 3.
-
eLS - Bromoviridae and Allies
Encyclopedia of Life Sciences, 2001Co-Authors: S. W. ScottAbstract:The family Bromoviridae consists of six genera: Alfamovirus, Anulavirus, Bromovirus, Cucumovirus, Ilarvirus and Oleavirus. All viruses in these genera possess tripartite genomes of single-stranded, linear, positive-sense ribonucleic acid (RNA), in which expression of the downstream codon of the RNA3 is via a subgenomic messenger RNA (mRNA) (RNA4). Raspberry bushy dwarf virus (RBDV) was the sole member of the genus Idaeovirus for many years and shares features in common with members of the genus Ilarvirus and Alfamovirus, but possesses a bipartite genome and is not currently assigned to a family. Members of the genera Alfamovirus, Bromovirus and Cucumovirus have been used extensively as model systems for research on molecular aspects of plant virology. Key Concepts: Although all members of the Bromoviridae have similar particle morphologies (quasi-spherical and bacilliform) and possess tripartite genomes, a range of different strategies is used to express the products of the different genomes. The phenomenon of genome activation by the coat protein was unique to the Ilarviruses and Alfalfa mosaic virus but has recently been demonstrated for RBDV. The natural host ranges of Cucumber mosaic virus and Alfalfa mosaic virus are extensive whereas many other viruses described in this article have an extremely limited natural host range. Complete genomic nucleotide sequences are available from GenBank for the majority of viruses referred to in this article. Keywords: Alfamovirus; Anulavirus; Bromovirus; Cucumovirus; Ilarvirus; Oleavirus; Idaeovirus
-
the sequence of rna 1 and rna 2 of tobacco streak virus additional evidence for the inclusion of alfalfa mosaic virus in the genus Ilarvirus
Archives of Virology, 1998Co-Authors: S. W. Scott, M T Zimmerman, X GeAbstract:Here we describe the complete sequence of RNA 1 and 2 of the WC isolate of tobacco streak virus (TSV). These two sequences complete the information on the genome of TSV, the type member of the genus Ilarvirus, and are the first sequences described for the RNA 1 and RNA 2 of a member of subgroup 1 of this genus. The sequences have a similar organization to those reported for the corresponding RNAs of other Ilarviruses. However, the putative translation products of these two molecules differ sufficiently from previously sequenced Ilarviruses so that TSV should remain in a subgroup on its own. Phylogenetic comparison of sequence data for RNA 1 with that of other Ilarviruses and alfalfa mosaic virus (AMV) reveals two distinct clusters (TSV, CiLRV, and SpLV) and (AMV, PDV, and ApMV). These data support the suggestion [16] based on data for RNA 3 of Ilarviruses that AMV should be included as a true Ilarvirus.
Robert R Martin - One of the best experts on this subject based on the ideXlab platform.
-
genomic sequences of blackberry chlorotic ringspot virus and strawberry necrotic shock virus and the phylogeny of viruses in subgroup 1 of the genus Ilarvirus
Archives of Virology, 2010Co-Authors: Ioannis E Tzanetakis, Robert R Martin, S. W. ScottAbstract:Three members of subgroup 1 of the genus Ilarvirus: blackberry chlorotic ringspot (BCRV), strawberry necrotic shock (SNSV), and tobacco streak viruses (TSV), may infect Rubus and Fragaria species. All cause symptoms similar to those previously attributed to infection by TSV alone. Although similarities exist among the genomic sequences of the three, phylogenetic analysis shows them to be distinct viruses. These viruses and Parietaria mottle virus, the other currently accepted member of subgroup 1, appear to have evolved from a common ancestral virus, share conserved motifs in the products of the genomic RNAs, and constitute a distinct subgroup within the genus.
-
a new Ilarvirus found in rose
Plant Pathology, 2006Co-Authors: Ioannis E Tzanetakis, Robert R Martin, Rose C GergerichAbstract:Globularia nudicaulis (family Globulariaceae ) is a perennial, found naturally on European mountains at altitudes between 900 and 2000 m. In June 2004, G. nudicaulis plants, with a yellow mosaic and/or variegation on malformed leaves, were noted among plant species cultivated in the Botanical Garden at Bologna University, Italy. No elongated virus-like particles were observed in affected-leaf extracts by transmission electron microscopy using a leaf dip method. By applying a protein A sandwich enzyme-linked immunosorbent assay (PAS-ELISA) technique (Edwards & Cooper, 1985), Cucumber mosaic virus (CMV) was detected using a polyclonal antiserum (PVAS 30, American Type Culture Collection, Manassas, VA, USA). CMV from G . nudicaulis leaves was mechanically transmitted to 10 of 14 species tested. Local lesions were observed in Chenopodium murale and C. quinoa ; systemic symptoms were observed in Nicotiana tabacum , N. benthamiana , N. glutinosa , N. clevelandii and Capsicum annuum , and Cucumis sativus and C. melo . Reverse transcription-polymerase chain reaction (RT-PCR) and single-strand conformation polymorphism (SSCP) were employed to characterize the CMV isolate. Total RNA was extracted from affected G. nudicaulis leaf samples with a RNeasy Plant Minikit (Qiagen) according to the manufacturer’s instructions. RT-PCR was carried out using specific primers for the movement protein gene of RNA3 of CMV (forward MP + CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt, and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938nt to 959nt; Lin et al ., 2004). All samples yielded DNA fragments of the expected size: 841 bp. PCR products were then analysed by SSCP to identify specific sequence variants and compare genetic relationships with other CMV isolates from the Botanical Garden (MGB & SD, unpublished results). The results showed a sequence variant that was different from other local CMV isolates, indicating that CMV isolate G in G. nudicaulis is a new accession in this location. This is the first time that CMV has been isolated from G. nudicaulis.
-
new features in the genus Ilarvirus revealed by the nucleotide sequence of fragaria chiloensis latent virus
Virus Research, 2005Co-Authors: Ioannis E Tzanetakis, Robert R MartinAbstract:Abstract Fragaria chiloensis latent virus (FClLV), a member of the genus Ilarvirus was first identified in the early 1990s. Double-stranded RNA was extracted from FClLV infected plants and cloned. The complete nucleotide sequence of the virus has been elucidated. RNA 1 encodes a protein with methyltransferase and helicase enzymatic motifs while RNA 2 encodes the viral RNA dependent RNA polymerase and an ORF, that shares no homology with other Ilarvirus genes. RNA 3 codes for movement and coat proteins and an additional ORF, making FClLV possibly the first Ilarvirus encoding a third protein in RNA 3. Phylogenetic analysis reveals that FClLV is most closely related to Prune dwarf virus , the type member of subgroup 4 of the Ilarvirus genus. FClLV is also closely related to Alfalfa mosaic virus (AlMV), a virus that shares many properties with Ilarviruses. We propose the reclassification of AlMV as a member of the Ilarvirus genus instead of being a member of a distinct genus.
X Ge - One of the best experts on this subject based on the ideXlab platform.
-
viruses in subgroup 2 of the genus Ilarvirus share both serological relationships and characteristics at the molecular level
Archives of Virology, 2003Co-Authors: S. W. Scott, M T Zimmerman, X GeAbstract:Sequence data have been determined for 5 members of subgroup 2 of the genus Ilarvirus. These data support the known serological relationships among accepted members of this group and indicate that the Ilarvirus Hydrangea mosaic virus (HdMV) is an isolate of Elm mottle virus (EMoV). The close relationships between members of this subgroup, exhibited through the coat proteins coded on RNA 3, extend to the other genomic molecules. Primers designed from the sequences of RNA 1 and RNA 2 of EMoV amplified fragments from all other subgroup 2 viruses but not from other Ilarviruses. Although closely related, members of this subgroup occur naturally in distinctly different host species. The possible origins of the viruses are discussed in relation to similarities among the genomic molecules, in particular RNA 3.
-
the sequence of rna 1 and rna 2 of tobacco streak virus additional evidence for the inclusion of alfalfa mosaic virus in the genus Ilarvirus
Archives of Virology, 1998Co-Authors: S. W. Scott, M T Zimmerman, X GeAbstract:Here we describe the complete sequence of RNA 1 and 2 of the WC isolate of tobacco streak virus (TSV). These two sequences complete the information on the genome of TSV, the type member of the genus Ilarvirus, and are the first sequences described for the RNA 1 and RNA 2 of a member of subgroup 1 of this genus. The sequences have a similar organization to those reported for the corresponding RNAs of other Ilarviruses. However, the putative translation products of these two molecules differ sufficiently from previously sequenced Ilarviruses so that TSV should remain in a subgroup on its own. Phylogenetic comparison of sequence data for RNA 1 with that of other Ilarviruses and alfalfa mosaic virus (AMV) reveals two distinct clusters (TSV, CiLRV, and SpLV) and (AMV, PDV, and ApMV). These data support the suggestion [16] based on data for RNA 3 of Ilarviruses that AMV should be included as a true Ilarvirus.
-
The complete sequence of the genomic RNAs of spinach latent virus
Archives of Virology, 1997Co-Authors: X Ge, S. W. Scott, M T ZimmermanAbstract:We describe the sequence for the complete genome of spinach latent virus (SpLV). Comparisons of this genome with that of the only other complete genome described for a species within the genus Ilarvirus (citrus leaf rugose virus – CiLRV) indicate that while there are marked differences between the RNA 3 of the two viruses, their respective RNAs 1 and 2 share many similarities. However, the putative 2a protein of SpLV contains a C_2H_2 type “zinc finger”-like motif located towards the carboxy terminal of the protein which is absent in CiLRV and has not been reported for other members of the family Bromoviridae. A second open reading frame (2b), located at a similar position to that described for the cucumoviruses, occurs in the RNA 2 of both SpLV and CiLRV. The putative coat protein of SpLV is similar to that of citrus variegation virus (CVV) and asparagus virus 2 (AV-2), both members of subgroup 2 of the Ilarviruses. We have subsequently demonstrated a serological relationship between SpLV and other viruses in subgroup 2 and suggest that SpLV should be included in this subgroup rather than remain in a separate group (subgroup 6). However, while the putative movement protein of SpLV is remarkably similar to that of AV-2, it shows little relationship with the corresponding protein of CVV and the lack of similarity suggests that a recombination event may have occurred in the past. The relationship between the genera Alfamovirus and Ilarvirus is discussed in the light of the data for the genome of SpLV and recently published information for other members of the genus Ilarvirus .
-
A plant viral coat protein RNA binding consensus sequence contains a crucial arginine.
The EMBO Journal, 1996Co-Authors: P Ansel-mckinney, X Ge, S. W. Scott, M Swanson, Lee GehrkeAbstract:Abstract A defining feature of alfalfa mosaic virus (AMV) and Ilarviruses [type virus: tobacco streak virus (TSV)] is that, in addition to genomic RNAs, viral coat protein is required to establish infection in plants. AMV and TSV coat proteins, which share little primary amino acid sequence identity, are functionally interchangeable in RNA binding and initiation of infection. The lysine-rich amino-terminal RNA binding domain of the AMV coat protein lacks previously identified RNA binding motifs. Here, the AMV coat protein RNA binding domain is shown to contain a single arginine whose specific side chain and position are crucial for RNA binding. In addition, the putative RNA binding domain of two Ilarvirus coat proteins, TSV and citrus variegation virus, is identified and also shown to contain a crucial arginine. AMV and Ilarvirus coat protein sequence alignment centering on the key arginine revealed a new RNA binding consensus sequence. This consensus may explain in part why heterologous viral RNA-coat protein mixtures are infectious.
-
The nucleotide sequence of citrus leaf rugose virus RNA 1.
The Journal of general virology, 1995Co-Authors: S. W. Scott, X GeAbstract:The nucleotide sequence of citrus leaf rugose virus (CiLRV) RNA 1 consists of 3404 nucleotides and contains one open reading frame (ORF) which encodes a putative translation product of 1051 amino acids with a calculated M(r) of 118339. Both the nucleotide sequence of CiLRV RNA 1 and its translated polypeptide share similarities with those of the RNA 1 of alfalfa mosaic virus. However, the relationship is not as close as that which exists between the polymerase signatures of the two viruses, which are found on RNA 2. This is the first report of the full-length sequence for the RNA 1 of an Ilarvirus and completes the first sequence for an entire Ilarvirus genome. If it is typical of members of the genus then, as has long been speculated, the genomic organization of Ilarviruses is identical to that of other genera in the family Bromoviridae.
Ioannis E Tzanetakis - One of the best experts on this subject based on the ideXlab platform.
-
a novel Ilarvirus is associated with privet necrotic ringspot disease in the southern united states
Phytopathology, 2016Co-Authors: Nina Aboughanemsabanadzovic, Ioannis E Tzanetakis, Amanda M Lawrence, Ronald C Stephenson, Sead SabanadzovicAbstract:Necrotic ringspot disease (NRSD) is a graft-transmissible disorder of privet (synonym ligustrum), originally reported from Florida and Louisiana more than 50 years ago. In this communication we report an isometric virus isolated from Japanese privet (Ligustrum japonicum) collected in the southern United States displaying symptoms resembling those of NRSD. In mechanical transmission tests, the virus induced systemic infections in several herbaceous hosts. Double-stranded RNA analysis showed a pattern resembling replicative forms of members of the family Bromoviridae. The genome organization along with phylogenetic analyses and serological tests revealed that the virus belongs to subgroup 1 of the genus Ilarvirus. Pairwise comparisons with recognized Ilarviruses indicated that the virus is a distinct, and as yet, undescribed member in the taxon, for which we propose the name Privet ringspot virus (PrRSV). Furthermore, the near-perfect association of PrRSV infections with symptoms, and apparent absence of an...
-
Population structure of blackberry chlorotic ringspot virus in the United States
Archives of Virology, 2012Co-Authors: Bindu Poudel, Ioannis E TzanetakisAbstract:Blackberry chlorotic ringspot virus is a subgroup 1 Ilarvirus, detected in several rosaceous hosts exhibiting disease symptoms in Europe and the United States. The population structure of the virus was studied using isolates collected from wild and cultivated plants from six states in the United States. The results suggest a homogeneous virus population in the United States, similar to what observed within single orchards for other Ilarviruses. Given the lack of evidence for host or geography-driven adaptation, it is hypothesized that the virus was recently introduced into the New World.
-
genomic sequences of blackberry chlorotic ringspot virus and strawberry necrotic shock virus and the phylogeny of viruses in subgroup 1 of the genus Ilarvirus
Archives of Virology, 2010Co-Authors: Ioannis E Tzanetakis, Robert R Martin, S. W. ScottAbstract:Three members of subgroup 1 of the genus Ilarvirus: blackberry chlorotic ringspot (BCRV), strawberry necrotic shock (SNSV), and tobacco streak viruses (TSV), may infect Rubus and Fragaria species. All cause symptoms similar to those previously attributed to infection by TSV alone. Although similarities exist among the genomic sequences of the three, phylogenetic analysis shows them to be distinct viruses. These viruses and Parietaria mottle virus, the other currently accepted member of subgroup 1, appear to have evolved from a common ancestral virus, share conserved motifs in the products of the genomic RNAs, and constitute a distinct subgroup within the genus.
-
a new Ilarvirus found in rose
Plant Pathology, 2006Co-Authors: Ioannis E Tzanetakis, Robert R Martin, Rose C GergerichAbstract:Globularia nudicaulis (family Globulariaceae ) is a perennial, found naturally on European mountains at altitudes between 900 and 2000 m. In June 2004, G. nudicaulis plants, with a yellow mosaic and/or variegation on malformed leaves, were noted among plant species cultivated in the Botanical Garden at Bologna University, Italy. No elongated virus-like particles were observed in affected-leaf extracts by transmission electron microscopy using a leaf dip method. By applying a protein A sandwich enzyme-linked immunosorbent assay (PAS-ELISA) technique (Edwards & Cooper, 1985), Cucumber mosaic virus (CMV) was detected using a polyclonal antiserum (PVAS 30, American Type Culture Collection, Manassas, VA, USA). CMV from G . nudicaulis leaves was mechanically transmitted to 10 of 14 species tested. Local lesions were observed in Chenopodium murale and C. quinoa ; systemic symptoms were observed in Nicotiana tabacum , N. benthamiana , N. glutinosa , N. clevelandii and Capsicum annuum , and Cucumis sativus and C. melo . Reverse transcription-polymerase chain reaction (RT-PCR) and single-strand conformation polymorphism (SSCP) were employed to characterize the CMV isolate. Total RNA was extracted from affected G. nudicaulis leaf samples with a RNeasy Plant Minikit (Qiagen) according to the manufacturer’s instructions. RT-PCR was carried out using specific primers for the movement protein gene of RNA3 of CMV (forward MP + CATGGCTTTCCAAGGTACCAG, genomic position 118nt to 138nt, and reverse CTAAAGACCGTTAACCACCTGC, genomic position 938nt to 959nt; Lin et al ., 2004). All samples yielded DNA fragments of the expected size: 841 bp. PCR products were then analysed by SSCP to identify specific sequence variants and compare genetic relationships with other CMV isolates from the Botanical Garden (MGB & SD, unpublished results). The results showed a sequence variant that was different from other local CMV isolates, indicating that CMV isolate G in G. nudicaulis is a new accession in this location. This is the first time that CMV has been isolated from G. nudicaulis.
-
new features in the genus Ilarvirus revealed by the nucleotide sequence of fragaria chiloensis latent virus
Virus Research, 2005Co-Authors: Ioannis E Tzanetakis, Robert R MartinAbstract:Abstract Fragaria chiloensis latent virus (FClLV), a member of the genus Ilarvirus was first identified in the early 1990s. Double-stranded RNA was extracted from FClLV infected plants and cloned. The complete nucleotide sequence of the virus has been elucidated. RNA 1 encodes a protein with methyltransferase and helicase enzymatic motifs while RNA 2 encodes the viral RNA dependent RNA polymerase and an ORF, that shares no homology with other Ilarvirus genes. RNA 3 codes for movement and coat proteins and an additional ORF, making FClLV possibly the first Ilarvirus encoding a third protein in RNA 3. Phylogenetic analysis reveals that FClLV is most closely related to Prune dwarf virus , the type member of subgroup 4 of the Ilarvirus genus. FClLV is also closely related to Alfalfa mosaic virus (AlMV), a virus that shares many properties with Ilarviruses. We propose the reclassification of AlMV as a member of the Ilarvirus genus instead of being a member of a distinct genus.
M T Zimmerman - One of the best experts on this subject based on the ideXlab platform.
-
purification and properties of blackberry chlorotic ringspot a new virus species in subgroup 1 of the genus Ilarvirus found naturally infecting blackberry in the uk
Annals of Applied Biology, 2006Co-Authors: A. T. Jones, M T Zimmerman, Wendy J Mcgavin, V Gepp, S. W. ScottAbstract:A mechanically transmissible virus was isolated from Bedford Giant blackberry plants showing chlorotic mottling and ringspot symptoms growing in Scotland. It infected several herbaceous test plants, many of them symptomlessly. This virus was also transmitted to several Rubus species and cultivars by graft inoculation with scions from the field-infected Bedford Giant plant. Most grafted plants were infected symptomlessly, but Himalaya Giant blackberry and the hybrid berry Tayberry developed symptoms similar to those in the infected Bedford Giant plant. In the sap of infected Chenopodium quinoa, the virus lost infectivity when diluted 10 -4 but not 10 -3 , after 6 h and 48 h when kept at 20°C and 4°C, respectively, but was infective for more than 8 days when kept at -15°C. Preparations of purified virus from infected C. quinoa or spinach sedimented as three major nucleoprotein components and consisted of quasi-isometric particles that varied in size from 24 to 32 nm in diameter and that were not penetrated by negative stain. Such virus particle preparations contained a major polypeptide of ca 28 kDa and three single-stranded RNA species of estimated size 3.2, 2.8 and 2.1 kb. The complete sequence of the largest RNA (RNA 1, 3478 nt) and the partial sequence of the other RNAs (1863 and 2102 nt long, respectively) were determined and compared with sequences in databases. These findings, together with the biological and biochemical properties of this virus, indicate that it should be regarded as a distinct species in subgroup 1 of the genus Ilarvirus even though it was serologically unrelated to existing members of this subgroup. The virus showed a very distant serological relationship with prune dwarf virus (PDV) but differed significantly from it in the amino acid sequence of its coat protein, experimental host range and symptomatology and was unrelated to PDV at the molecular level. The virus, tentatively named blackberry chlorotic ringspot virus, is therefore a newly described virus and the first Ilarvirus found naturally infecting Rubus in the UK.
-
viruses in subgroup 2 of the genus Ilarvirus share both serological relationships and characteristics at the molecular level
Archives of Virology, 2003Co-Authors: S. W. Scott, M T Zimmerman, X GeAbstract:Sequence data have been determined for 5 members of subgroup 2 of the genus Ilarvirus. These data support the known serological relationships among accepted members of this group and indicate that the Ilarvirus Hydrangea mosaic virus (HdMV) is an isolate of Elm mottle virus (EMoV). The close relationships between members of this subgroup, exhibited through the coat proteins coded on RNA 3, extend to the other genomic molecules. Primers designed from the sequences of RNA 1 and RNA 2 of EMoV amplified fragments from all other subgroup 2 viruses but not from other Ilarviruses. Although closely related, members of this subgroup occur naturally in distinctly different host species. The possible origins of the viruses are discussed in relation to similarities among the genomic molecules, in particular RNA 3.
-
the sequence of rna 1 and rna 2 of tobacco streak virus additional evidence for the inclusion of alfalfa mosaic virus in the genus Ilarvirus
Archives of Virology, 1998Co-Authors: S. W. Scott, M T Zimmerman, X GeAbstract:Here we describe the complete sequence of RNA 1 and 2 of the WC isolate of tobacco streak virus (TSV). These two sequences complete the information on the genome of TSV, the type member of the genus Ilarvirus, and are the first sequences described for the RNA 1 and RNA 2 of a member of subgroup 1 of this genus. The sequences have a similar organization to those reported for the corresponding RNAs of other Ilarviruses. However, the putative translation products of these two molecules differ sufficiently from previously sequenced Ilarviruses so that TSV should remain in a subgroup on its own. Phylogenetic comparison of sequence data for RNA 1 with that of other Ilarviruses and alfalfa mosaic virus (AMV) reveals two distinct clusters (TSV, CiLRV, and SpLV) and (AMV, PDV, and ApMV). These data support the suggestion [16] based on data for RNA 3 of Ilarviruses that AMV should be included as a true Ilarvirus.
-
The complete sequence of the genomic RNAs of spinach latent virus
Archives of Virology, 1997Co-Authors: X Ge, S. W. Scott, M T ZimmermanAbstract:We describe the sequence for the complete genome of spinach latent virus (SpLV). Comparisons of this genome with that of the only other complete genome described for a species within the genus Ilarvirus (citrus leaf rugose virus – CiLRV) indicate that while there are marked differences between the RNA 3 of the two viruses, their respective RNAs 1 and 2 share many similarities. However, the putative 2a protein of SpLV contains a C_2H_2 type “zinc finger”-like motif located towards the carboxy terminal of the protein which is absent in CiLRV and has not been reported for other members of the family Bromoviridae. A second open reading frame (2b), located at a similar position to that described for the cucumoviruses, occurs in the RNA 2 of both SpLV and CiLRV. The putative coat protein of SpLV is similar to that of citrus variegation virus (CVV) and asparagus virus 2 (AV-2), both members of subgroup 2 of the Ilarviruses. We have subsequently demonstrated a serological relationship between SpLV and other viruses in subgroup 2 and suggest that SpLV should be included in this subgroup rather than remain in a separate group (subgroup 6). However, while the putative movement protein of SpLV is remarkably similar to that of AV-2, it shows little relationship with the corresponding protein of CVV and the lack of similarity suggests that a recombination event may have occurred in the past. The relationship between the genera Alfamovirus and Ilarvirus is discussed in the light of the data for the genome of SpLV and recently published information for other members of the genus Ilarvirus .
