The Experts below are selected from a list of 294 Experts worldwide ranked by ideXlab platform
Giovanni P. Martelli - One of the best experts on this subject based on the ideXlab platform.
-
Grapevine fleck and similar viruses
Grapevine Viruses: Molecular Biology Diagnostics and Management, 2017Co-Authors: Sead Sabanadzovic, Nina Aboughanem-sabanadzovic, Giovanni P. MartelliAbstract:Grapevine fleck virus (GFkV), grapevine red globe virus (GRGV), grapevine rupestris vein feathering virus (GRVFV), grapevine asteroid mosaic-associated virus (GAMaV), and grapevine Syrah virus 1 (GSyV-1) are a group of evolutionarily related viruses with similar morphological, physicochemical, and molecular properties. GFkV is the agent of fleck disease, and GAMaV and GRVFV are associated with asteroid mosaic and vein feathering diseases, respectively, while GRGV is not involved in any specific symptomatology. GSyV-1 is included in this chapter as it shares many traits with the four aforementioned viruses, but has not yet been associated with any particular syndrome. All these viruses are phloem limited, nonmechanically transmissible, and primarily spread through infected propagating material. GFkV is ubiquitous, while the other viruses have been reported only from certain geographical areas. Despite few unconfirmed reports of natural field transmission of GFkV, no vector has been identified for it, nor any of the other viruses. Viral genomes consist of a single molecule of a capped and polyadenylated, cytosine-rich, messenger-like RNA 6.5–7.5 kb in size. According to the current taxonomy, these viruses belong to recognized or putative species in the genera Maculavirus (GFkV and GRGV) and Marafivirus (GSyV-1, GRVFV, and GAMaV) in the family Tymoviridae, order Tymovirales.
-
Complete sequence of Fig fleck-associated virus, a novel member of the family Tymoviridae
Virus research, 2011Co-Authors: Toufic Elbeaino, Michele Digiaro, Giovanni P. MartelliAbstract:The complete nucleotide sequence and the genome organization were determined of a novel virus, tentatively named Fig fleck-associated virus (FFkaV). The viral genome is a positive-sense, single-stranded RNA 7046 nucleotides in size excluding the 3'-terminal poly(A) tract, and comprising two open reading frames. ORF1 encodes a polypeptide of 2161 amino acids (p240), which contains the signatures of replication-associated proteins and the coat protein cistron (p24) at its 3' end. ORF2 codes for a 461 amino acid protein (p50) identified as a putative movement proteins (MP). In phylogenetic trees constructed with sequences of the putative polymerase and CP proteins FFkaV consistently groups with members of the genus Maculavirus, family Tymoviridae. However, the genome organization diverges from that of the two completely sequenced maculaviruses, Grapevine fleck virus (GFkV) and Bombix mori Macula-like virus (BmMLV), as it exhibits a structure resembling that of Maize rayado fino virus (MRFV), the type species of the genus Marafivirus and of Olive latent virus 3 (OLV-3), an unclassified virus in the family Tymoviridae. FFkaV was found in field-grown figs from six Mediterranean countries with an incidence ranging from 15% to 25%.
-
Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.
Virus research, 2010Co-Authors: Abdulkader Alabdullah, Toufic Elbeaino, Angelantonio Minafra, Maria Saponari, Vito Savino, Giovanni P. MartelliAbstract:The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits.
-
Family Flexiviridae: a case study in virion and genome plasticity.
Annual review of phytopathology, 2007Co-Authors: Giovanni P. Martelli, Michael J. Adams, Jan Kreuze, Valerian V. DoljaAbstract:The plant virus family Flexiviridae includes the definitive genera Potexvirus, Mandarivirus, Allexivirus, Carlavirus, Foveavirus, Capillovirus, Vitivirus, Trichovirus, the putative genus Citrivirus, and some unassigned species. Its establishment was based on similarities in virion morphology, common features in genome type and organization, and strong phylogenetic relationships between replicational and structural proteins. In this review, we provide a brief account of the main biological and molecular properties of the members of the family, with special emphasis on the relationships within and among the genera. In phylogenetic analyses the potexvirus-like replicases were more closely related to tymoviruses than to carlaviruses. We postulate a common evolutionary ancestor for the family Tymoviridae and the two distinct evolutionary clusters of the Flexiviridae, i.e., a plant virus with a polyadenylated genome, filamentous virions, and a triple gene block of movement proteins. Subsequent recombination and gene loss would then have generated a very diverse group of plant and fungal viruses.
-
Family Flexiviridae: A Case Study in Virion and
2007Co-Authors: Giovanni P. Martelli, Michael J. Adams, Jan Kreuze, Valerian V. DoljaAbstract:The plant virus family Flexiviridae includes the definitive genera Potexvirus, Mandarivirus, Allexivirus, Carlavirus, Foveavirus, Capillovirus, Vitivirus, Trichovirus, the putative genus Citrivirus, and some unassigned species. Its establishment was based on similarities in virion morphology, common features in genome type and organization, and strong phylogenetic relationships between replicational and structural proteins. In this review, we provide a brief account of the main biological and molecular properties of the members of the family, with special emphasis on the relationships within and among the genera. In phylogenetic analyses the potexvirus-like replicases were more closely related to tymoviruses than to carlaviruses. We postulate a common evolutionary ancestor for the family Tymoviridae and the two distinct evolutionary clusters of the Flexiviridae, i.e., a plant virus with a polyadenylated genome, filamentous virions, and a triple gene block of movement proteins. Subsequent recombination and gene loss would then have generated a very diverse group of plant and fungal viruses.
Eric Delwart - One of the best experts on this subject based on the ideXlab platform.
-
High Variety of Known and New RNA and DNA Viruses of Diverse Origins in Untreated Sewage
Journal of virology, 2012Co-Authors: Rachel L. Marine, Beatrix Kapusinszky, Chunlin Wang, Peter Simmonds, Ladaporn Bodhidatta, Bamidele Soji Oderinde, K. E. Wommack, Eric DelwartAbstract:Deep sequencing of untreated sewage provides an opportunity to monitor enteric infections in large populations and for high-throughput viral discovery. A metagenomics analysis of purified viral particles in untreated sewage from the United States (San Francisco, CA), Nigeria (Maiduguri), Thailand (Bangkok), and Nepal (Kathmandu) revealed sequences related to 29 eukaryotic viral families infecting vertebrates, invertebrates, and plants (BLASTx E score, 90% protein identities) in numerous viral families infecting humans (Adenoviridae, Astroviridae, Caliciviridae, Hepeviridae, Parvoviridae, Picornaviridae, Picobirnaviridae, and Reoviridae), plants (Alphaflexiviridae, Betaflexiviridae, Partitiviridae, Sobemovirus, Secoviridae, Tombusviridae, Tymoviridae, Virgaviridae), and insects (Dicistroviridae, Nodaviridae, and Parvoviridae). The full and partial genomes of a novel kobuvirus, salivirus, and sapovirus are described. A novel astrovirus (casa astrovirus) basal to those infecting mammals and birds, potentially representing a third astrovirus genus, was partially characterized. Potential new genera and families of viruses distantly related to members of the single-stranded RNA picorna-like virus superfamily were genetically characterized and named Picalivirus, Secalivirus, Hepelivirus, Nedicistrovirus, Cadicistrovirus, and Niflavirus. Phylogenetic analysis placed these highly divergent genomes near the root of the picorna-like virus superfamily, with possible vertebrate, plant, or arthropod hosts inferred from nucleotide composition analysis. Circular DNA genomes distantly related to the plant-infecting Geminiviridae family were named Baminivirus, Nimivirus, and Niminivirus. These results highlight the utility of analyzing sewage to monitor shedding of viral pathogens and the high viral diversity found in this common pollutant and provide genetic information to facilitate future studies of these newly characterized viruses.
-
The Fecal Viral Flora of Wild Rodents
PLoS Pathogens, 2011Co-Authors: Tung Gia Phan, Beatrix Kapusinszky, Robe K. Rose, Chunlin Wang, Howard L. Lipton, Eric DelwartAbstract:The frequent interactions of rodents with humans make them a common source of zoonotic infections. To obtain an initial unbiased measure of the viral diversity in the enteric tract of wild rodents we sequenced partially purified, randomly amplified viral RNA and DNA in the feces of 105 wild rodents (mouse, vole, and rat) collected in California and Virginia. We identified in decreasing frequency sequences related to the mammalian viruses families Circoviridae, Picobirnaviridae, Picornaviridae, Astroviridae, Parvoviridae, Papillomaviridae, Adenoviridae, and Coronaviridae. Seventeen small circular DNA genomes containing one or two replicase genes distantly related to the Circoviridae representing several potentially new viral families were characterized. In the Picornaviridae family two new candidate genera as well as a close genetic relative of the human pathogen Aichi virus were characterized. Fragments of the first mouse sapelovirus and picobirnaviruses were identified and the first murine astrovirus genome was characterized. A mouse papillomavirus genome and fragments of a novel adenovirus and adenovirus-associated virus were also sequenced. The next largest fraction of the rodent fecal virome was related to insect viruses of the Densoviridae, Iridoviridae, Polydnaviridae, Dicistroviriade, Bromoviridae, and Virgaviridae families followed by plant virus-related sequences in the Nanoviridae, Geminiviridae, Phycodnaviridae, Secoviridae, Partitiviridae, Tymoviridae, Alphaflexiviridae, and Tombusviridae families reflecting the largely insect and plant rodent diet. Phylogenetic analyses of full and partial viral genomes therefore revealed many previously unreported viral species, genera, and families. The close genetic similarities noted between some rodent and human viruses might reflect past zoonoses. This study increases our understanding of the viral diversity in wild rodents and highlights the large number of still uncharacterized viruses in mammals.
-
Bat Guano Virome: Predominance of Dietary Viruses from Insects and Plants plus Novel Mammalian Viruses
Journal of virology, 2010Co-Authors: Joseph Victoria, Chunlin Wang, Gary M. Fellers, Thomas H. Kunz, Morris S. Jones, Eric DelwartAbstract:Bats are hosts to a variety of viruses capable of zoonotic transmissions. Because of increased contact between bats, humans, and other animal species, the possibility exists for further cross-species transmissions and ensuing disease outbreaks. We describe here full and partial viral genomes identified using metagenomics in the guano of bats from California and Texas. A total of 34% and 58% of 390,000 sequence reads from bat guano in California and Texas, respectively, were related to eukaryotic viruses, and the largest proportion of those infect insects, reflecting the diet of these insectivorous bats, including members of the viral families Dicistroviridae, Iflaviridae, Tetraviridae, and Nodaviridae and the subfamily Densovirinae. The second largest proportion of virus-related sequences infects plants and fungi, likely reflecting the diet of ingested insects, including members of the viral families Luteoviridae, Secoviridae, Tymoviridae, and Partitiviridae and the genus Sobemovirus. Bat guano viruses related to those infecting mammals comprised the third largest group, including members of the viral families Parvoviridae, Circoviridae, Picornaviridae, Adenoviridae, Poxviridae, Astroviridae, and Coronaviridae. No close relative of known human viral pathogens was identified in these bat populations. Phylogenetic analysis was used to clarify the relationship to known viral taxa of novel sequences detected in bat guano samples, showing that some guano viral sequences fall outside existing taxonomic groups. This initial characterization of the bat guano virome, the first metagenomic analysis of viruses in wild mammals using second-generation sequencing, therefore showed the presence of previously unidentified viral species, genera, and possibly families. Viral metagenomics is a useful tool for genetically characterizing viruses present in animals with the known capability of direct or indirect viral zoonosis to humans.
-
Bat guano virome: predominance of dietary viruses from insects and plants plus novel mammalian viruses
2010Co-Authors: Joseph G. Victoria, Chunlin Wang, Morris Jones, Gary M. Fellers, Thomas H. Kunz, Eric DelwartAbstract:Bats are hosts to a variety of viruses capable of zoonotic transmissions. Because of increased contact between bats, humans, and other animal species, the possibility exists for further cross-species transmis-sions and ensuing disease outbreaks. We describe here full and partial viral genomes identified using metagenomics in the guano of bats from California and Texas. A total of 34 % and 58 % of 390,000 sequence reads from bat guano in California and Texas, respectively, were related to eukaryotic viruses, and the largest proportion of those infect insects, reflecting the diet of these insectivorous bats, including members of the viral families Dicistroviridae, Iflaviridae, Tetraviridae, and Nodaviridae and the subfamily Densoviri-nae. The second largest proportion of virus-related sequences infects plants and fungi, likely reflecting the diet of ingested insects, including members of the viral families Luteoviridae, Secoviridae, Tymoviridae, and Partitiviridae and the genus Sobemovirus. Bat guano viruses related to those infecting mammals comprised the third largest group, including members of the viral families Parvoviridae, Circoviridae, Picornaviridae, Adenoviridae, Poxviridae, Astroviridae, and Coronaviridae. No close relative of known human viral pathogens was identified in these bat populations. Phylogenetic analysis was used to clarify the relationship to known viral taxa of novel sequences detected in bat guano samples, showing that some guano viral sequences fal
Theo W. Dreher - One of the best experts on this subject based on the ideXlab platform.
-
Turnip yellow mosaic virus: transfer RNA mimicry, chloroplasts and a C-rich genome.
Molecular plant pathology, 2004Co-Authors: Theo W. DreherAbstract:SUMMARY Taxonomy: Turnip yellow mosaic virus (TYMV) is the type species of the genus Tymovirus, family Tymoviridae. TYMV is a positive strand RNA virus of the alphavirus-like supergroup. Physical properties: Virions are non-enveloped 28-nm T = 3 icosahedrons composed of a single 20-kDa coat protein that is clustered in 20 hexameric and 12 pentameric subunits. Infectious particles and empty capsids coexist in infected tissue. The genomic RNA is 6.3 kb long, with a 5'(m7)GpppG cap and a 3' untranslated region ending in a tRNA-like structure to which valine can be covalently added. The genome has a distinctive skewed C-rich, G-poor composition (39% C, 17% G). Viral proteins: Two proteins, whose open reading frames extensively overlap, are translated from the genomic RNA. p206, which contains sequences indicative of RNA capping, NTPase/helicase and polymerase activities, is the only viral protein that is necessary for genome replication in single cells. It is produced as a polyprotein and self-cleaved to yield 141- and 66-kDa proteins. p69 is required for virus movement within the plant and is also a suppressor of gene silencing. The coat protein is expressed from the single subgenomic RNA. Hosts and symptoms: TYMV has a narrow host range almost completely restricted to the Cruciferae. Experimental host species are Brassica pekinensis (Chinese cabbage) or B. rapa (turnip), in which diffuse chlorotic local lesions and systemic yellow mosaic symptoms appear. Arabidopsis thaliana can also be used. Clumping of chloroplasts and the accumulation of vesicular invaginations of the chloroplast outer membranes are distinctive cytopathological symptoms. High yields of virus are produced in all leaf tissues, and the virus is readily transmissible by mechanical inoculation. Localized transmission by flea beetles may occur in the field.
-
The family Tymoviridae
Archives of virology, 2002Co-Authors: Giovanni P. Martelli, Sead Sabanadzovic, N. Abou-ghanem Sabanadzovic, Michael C. Edwards, Theo W. DreherAbstract:The family Tymoviridae comprises the genus Tymovirus, from which it derives its name, the genus Marafivirus and the newly established genus Maculavirus. Members of the family share the following characteristics: (i) non-enveloped isometric particles c. 30 um in diameter, with a rounded contour and prominent surface structures, and clustering of coat protein subunits in pentamers and hexamers; (ii) the presence in preparations of purified virus particles of two centrifugal components, made up of non-infectious protein shells (T) that may contain small amounts of RNA (primarily subgenomic coat protein mRNA) and of infectious nucleoproteins (B), that contain the virus genome; (iii) possession of a positive-sense, single-stranded RNA genome with an unusually high cytidine content (32 to c. 50%), capped at the 5' terminus and containing a very large ORF encodes replication-related proteins analogous to those of other taxa of the "alpha-like" supergroup of ssRNA viruses; (iv) a replication strategy possibly encompassing posttranslational proteolytic cleavage of the polypeptide encoded by ORF1 by a papain-like virus-encoded protease, and coat protein expression via a subgenomic RNA; (v) the presence in infected cells of cytopathic structures, thought to be the sites of RNA replication, originating from severely altered chloroplasts and/or mitochondria, the periphery of which is lined with vesicles produced by the localized invaginations of the bounding membrane. There are 23, 4, and 2 known species in the genera Tymovirus, Marafivirus and Maculavirus, respectively. The genus Marafivirus also contains one tentative species.
Michael G. K. Jones - One of the best experts on this subject based on the ideXlab platform.
-
Donkey Orchid Symptomless Virus: A Viral ‘Platypus’ from Australian Terrestrial Orchids
2016Co-Authors: Stephen J. Wylie, Michael G. K. JonesAbstract:Complete and partial genome sequences of two isolates of an unusual new plant virus, designated Donkey orchid symptomless virus (DOSV) were identified using a high-throughput sequencing approach. The virus was identified from asymptomatic plants of Australian terrestrial orchid Diuris longifolia (Common donkey orchid) growing in a remnant forest patch near Perth, western Australia. DOSV was identified from two D. longifolia plants of 264 tested, and from at least one plant of 129 Caladenia latifolia (pink fairy orchid) plants tested. Phylogenetic analysis of the genome revealed open reading frames (ORF) encoding seven putative proteins of apparently disparate origins. A 69-kDa protein (ORF1) that overlapped the replicase shared low identity with MPs of plant tymoviruses (Tymoviridae). A 157-kDa replicase (ORF2) and 22-kDa coat protein (ORF4) shared 32 % and 40 % amino acid identity, respectively, with homologous proteins encoded by members of the plant virus family Alphaflexiviridae. A 44-kDa protein (ORF3) shared low identity with myosin and an autophagy protein from Squirrelpox virus. A 27-kDa protein (ORF5) shared no identity with described proteins. A 14-kDa protein (ORF6) shared limited sequence identity (26%) over a limited region of the envelope glycoprotein precursor of mammal-infecting Crimea-Congo hemorrhagic fever virus (Bunyaviridae). The putative 25-kDa movement protein (MP) (ORF7) shared limited (27%) identity with 3A-like MPs of members of the plant-infecting Tombusviridae and Virgaviridae. Transmissibility was shown when DOS
-
Donkey orchid symptomless virus: a viral 'platypus' from Australian terrestrial orchids.
PloS one, 2013Co-Authors: Stephen J. Wylie, Michael G. K. JonesAbstract:Complete and partial genome sequences of two isolates of an unusual new plant virus, designated Donkey orchid symptomless virus (DOSV) were identified using a high-throughput sequencing approach. The virus was identified from asymptomatic plants of Australian terrestrial orchid Diuris longifolia (Common donkey orchid) growing in a remnant forest patch near Perth, western Australia. DOSV was identified from two D. longifolia plants of 264 tested, and from at least one plant of 129 Caladenia latifolia (pink fairy orchid) plants tested. Phylogenetic analysis of the genome revealed open reading frames (ORF) encoding seven putative proteins of apparently disparate origins. A 69-kDa protein (ORF1) that overlapped the replicase shared low identity with MPs of plant tymoviruses (Tymoviridae). A 157-kDa replicase (ORF2) and 22-kDa coat protein (ORF4) shared 32% and 40% amino acid identity, respectively, with homologous proteins encoded by members of the plant virus family Alphaflexiviridae. A 44-kDa protein (ORF3) shared low identity with myosin and an autophagy protein from Squirrelpox virus. A 27-kDa protein (ORF5) shared no identity with described proteins. A 14-kDa protein (ORF6) shared limited sequence identity (26%) over a limited region of the envelope glycoprotein precursor of mammal-infecting Crimea-Congo hemorrhagic fever virus (Bunyaviridae). The putative 25-kDa movement protein (MP) (ORF7) shared limited (27%) identity with 3A-like MPs of members of the plant-infecting Tombusviridae and Virgaviridae. Transmissibility was shown when DOSV systemically infected Nicotiana benthamiana plants. Structure and organization of the domains within the putative replicase of DOSV suggests a common evolutionary origin with 'potexvirus-like' replicases of viruses within the Alphaflexiviridae and Tymoviridae, and the CP appears to be ancestral to CPs of allexiviruses (Alphaflexiviridae). The MP shares an evolutionary history with MPs of dianthoviruses, but the other putative proteins are distant from plant viruses. DOSV is not readily classified in current lower order virus taxa.
-
Genome organization of Donkey orchid symptomless virus.
2013Co-Authors: Stephen J. Wylie, Michael G. K. JonesAbstract:Genome organization of Donkey orchid symptomless virus isolate Mariginiup11 (a), showing the nucleotide positions of open reading frames (ORF) including putative coat protein (CP), movement protein (MP), and untranslated regions (UTR), and calculated sizes of putative proteins. Open reading frames were designated with respect to the replicase (ORF1). Diagrams of genome organization of (b) Garlic virus A (family Alphaflexiviridae, genus Allexivirus) encodes a 40-kDa protein (P40) and nucleotide binding protein (NTBP), (c) Plantago asiatica mosaic virus (Alphaflexiviridae, Potexvirus), (d) Tomato bushy stunt virus (TBSV) (Tombusviridae, Tombusvirus), (e) Sorghum chlorotic spot virus (SCSV) (Tombusviridae, Furovirus), and (f) Turnip yellow mosaic virus (Tymoviridae, Tymovirus) are shown (not drawn to scale). Within the replicase, the papain-like protease (P), methyltransferase (M), helicase (H), and RNA-dependent RNA polymerase (RdRp) domains are indicated where present. In TBSV and SCSV, read-through opal stop codons are indicated by a dotted line, R-T = read-through region, and C-R = cysteine-rich protein.
-
Evolutionary relationships of Donkey orchid symptomless virus replicase and coat protein.
2013Co-Authors: Stephen J. Wylie, Michael G. K. JonesAbstract:Donkey orchid symptomless virus (DOSV) (represented with a black dot) replicase (a), and coat protein (b) using a General Reverse Transcription model with homologous proteins of representative viruses within the order Tymovirales. Relationships were inferred for amino acid sequences using the Maximum Likelihood method. The abbreviated names of the viruses used and their GenBank accession codes are shown. Genus names are given on the right. Genus names are colored according to family classification. Orange represents the Alphaflexiviridae, red represents the Gammaflexiviridae, green represents the Tymoviridae, and blue represents the Betaflexiviridae. The position of DOSV isolates are shown as black dots. ACLSV, Apple chlorotic leaf spot virus; ALV, Apricot latent virus; APLV, Andean potato latent virus; ASGV, Apple stem grooving virus; ASPV, Apple stem pitting virus; BVF, Botrytis virus F; BVX, Botrytis virus X; CLBV, Citrus leaf blotch virus; CMLV, Cherry mottle leaf virus; CVA, Cherry virus A; GarVA, Garlic virus A; GarVC, Garlic virus C; GarVE, Garlic virus E; GCLV, Garlic common latent virus; GFkV, Grapevine fleck virus; GVA, Grapevine virus A; GVB, Grapevine virus B; ICRSV, Indian citrus ringspot virus; LoLV, Lolium latent virus; MRFV, Maize rayado fino virus; OVX, Opuntia virus X; PepMV, Pepino mosaic virus; PlAMV, Plantago asiatica mosaic virus; PVT, Potato virus T; PVX, Potato virus X; SLV, Shallot latent virus; SMYEV, Strawberry mild yellow edge virus; SsDRV, Sclerotinia sclerotiorum debilitation-associated RNA virus; SWMV, Switchgrass mosaic virus; TYMV, Turnip yellow mosaic virus; WClMV, White clover mosaic virus. The percentage of replicate trees above 60 % in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches. Units are amino acid substitutions per site.
Naidu Rayapati - One of the best experts on this subject based on the ideXlab platform.
-
First Report of grapevine red globe virus in grapevines in Washington State.
Plant disease, 2020Co-Authors: Sridhar Jarugula, Nomatter Chingandu, Jati Adiputra, Basavaraj Bagewadi, Raphael O. Adegbola, Chandrasekhar Thammina, Naidu RayapatiAbstract:Grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) has been reported in grapevines (Vitis spp.) from Italy, Greece, France, China, Spain and Germany and in California, U.S.A. (Sabanadzovic et al. 2000; Cretazzo et al. 2017; Fan et al. 2016; Ruiz-Garcia et al., 2018). During surveys of grapevine nurseries, a total of 241 composite samples, each consisting of four petioles from mature leaves/vine from five asymptomatic grapevines, from 33 grapevine (Vitis vinifera) cultivars were collected. Total RNA isolated from these samples using Spectrum Total RNA isolation kit (Sigma-Aldrich, St. Louis, MO) was subjected to high-throughput sequencing (HTS) on an Illumina HiSeq2500 or Novaseq 6000 platforms in paired-end mode (Genomics Core Facility, Huntsman Cancer Institute, Utah University, Salt Lake City, UT). After trimming raw reads based on quality and ambiguity, the paired-end quality reads of approximately 120 (HiSeq) or 145 (Novaseq) base pair (bp) length were assembled de novo into a pool of contigs (CLC Genomics workbench 12). These contigs were subjected to BLASTn analysis against the nonredundant virus database from GenBank (http://www.ncbi.nlm.nih.gov/blast). A total of 49 contig sequences, ranging from 200 to 1645 bp in length with an average coverage ranging up to 418.7, aligning with GRGV genome were detected in cvs. Aglianico, Cabernet franc, Pinot gris and Riesling. BLASTn analysis of contigs greater than 500 bp length showed sequence identity between 88.5% and 95% with corresponding GRGV sequences reported from other countries. These results indicated the presence of genetically distinct isolates of GRGV. HTS data also revealed coinfection of GRGV in all samples with one or more of the following virus and/or viroids: grapevine rupestris stem pitting associated virus, grapevine rupestris vein feathering virus, hop stunt viroid or grapevine yellow speckle viroid-1. To further confirm infection by GRGV, total RNA was extracted from two asymptomatic Pinot gris vines previously tested positive in HTS using Spectrum Total RNA isolation kit and subjected to reverse transcription-PCR using primers specific to the replicase polyprotein gene of the virus (RG4847F: 5'-TGGTCTGTTGTTCGCATCTT-3' and RG6076R: 5' CGGAAGGGGAAGCATTGATCT-3', Cretazzo et al., 2017). Sequence analysis of the approximately1,250 bp amplicons (accession number MT749359) showed 91.2 % nt sequence identity with corresponding sequence of GRGV isolate from Brazil (KX828704.1). To our knowledge, this is the first report of GRGV in Washington State. Together with the report of the occurrence of GRGV in California (Sabanadzovic et al. 2000), these/span> results indicate wide geographical distribution of the virus. Although GRGV can cause asymptomatic infections in grapevines (Martelli et al. 2002), the economic importance of GRGV as single or coinfections with other viruses needs to be examined to assess the potential significance of the virus to grape production and grapevine certification programs.
-
First report of grapevine rupestris vein feathering virus in grapevines from Washington State.
Plant disease, 2020Co-Authors: Nomatter Chingandu, Sridhar Jarugula, Jati Adiputra, Basavaraj Bagewadi, Raphael O. Adegbola, Chandrasekhar Thammina, Naidu RayapatiAbstract:Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5'- TACAAGGTGAATTGCTCCACAC -3') and SaR-1027 (5'-TCATTGGCGATGCGTTCG-3') to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.
